KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit anti-G6PD antibody | Abcam | RRID:AB_296714 Cat #ab993 |
| Mouse anti-rabbit HRP secondary antibody | Cell Signal | RRID: AB_10892860 Cat #5127 |
| Biological samples | ||
| Human Ovarian Tumor Samples | Duke University School of Medicine Ovarian Cancer Research Biobank | ID: Pro00013710 (Banking Normal and Malignant Gynecologic Tissues Removed at Surgery) |
| Chemicals, peptides, and recombinant proteins | ||
| Polydatin | Sigma-Aldrich | Cat #15721 |
| LentiX Concentrator (100X) | Takara Bio | Cat # 631232 |
| Transdux Virus Transduction Reagent | System Biosciences | Cat # LV850A-1 |
| DCFH-DA (2′,7′-Dichlorofluorescein diacetate) | Millipore Sigma | Cat #35845 |
| Critical commercial assays | ||
| Glucose-6-Phosphate Dehydrogenase Activity Assay Kit | Millipore Sigma | Cat #MAK015 |
| SYTOX™ Blue Dead Cell Stain | Thermofisher Scientific | Cat #S34857 |
| RNeasy RNA Isolation Kit | Qiagen | Cat #74106 |
| RevertAid First Strand cDNA Synthesis Kit | Thermofisher Scientific | Cat #K1621 |
| Deposited data | ||
| High throughput sequencing of primary and metastatic tumor samples from patients with differing stage of serous epithelial ovarian cancer | Shih et al., 2018 | GEO: GSE118828 |
| Expression profiling by array of ovarian tumors and metastases from the omentum | Brodsky et al., 2014 | GEO: GSE30587 |
| Human HGSOC Ovarian Cancer Metabolomics (Primary vs. Omental Metastases) | This Paper | Mendeley Data: https://doi.org/10.17632/ztmzp4dc3y.1 |
| Experimental models: Cell lines | ||
| Human: HEYA8 cells | ATCC | RRID:CVCL_8878 |
| Human: SKOV3 cells | ATCC | RRID:CVCL_0532 |
| Human: IGROV1 cells | ATCC | RRID:CVCL_1304 |
| Human: TykNu cells | Duke Gynecological Oncology Core Resource | N/A |
| Human: Ovaca424 cells | Duke Gynecological Oncology Core Resource | N/A |
| Human: Ovaca432 cells | Duke Gynecological Oncology Core Resource | N/A |
| Human: DOV13 cells | Duke Gynecological Oncology Core Resource | N/A |
| Human: CaOV2 cells | Duke Gynecological Oncology Core Resource | N/A |
| Human: Ovcar8 cells | Duke Gynecological Oncology Core Resource | N/A |
| Human: OV90 cells | Duke Gynecological Oncology Core Resource | N/A |
| Experimental models: Organisms/strains | ||
| Mouse: NOD.Cg-Prkdcscid/J | The Jackson Lab | RRID:IMSR_JAX:001303 |
| Strain #:001303 | ||
| Mouse: Outbred, Athymic Nude | The Jackson Lab | RRID:IMSR_JAX:002019 |
| (homozygous for Foxn1nu) | Strain #:002019 | |
| Oligonucleotides | ||
| pLKO-puro-G6PD shRNA (CAACAGATACAAGAACGTGAA) | RNAi Consortium shRNA Library (MISSION shRNA library) | TRC Clone ID: TRCN0000025817 |
| Actin (ACTB) TaqMan Assay (Hs01060665_g1) | Thermofisher Scientific | Cat #:4453320 |
| G6PD (G6PD) TaqMan Assay (Hs00166169_m1) | Thermofisher Scientific | Cat #:4453320 |
| Recombinant DNA | ||
| pAAV-HyPer-DAAO-NES | Steinhorn et al., 2018 | Addgene Plasmid #119164 |
| pLVX-IRES-Puro-iNap1 plasmid | Tao et al., (2017) (MTA from East China University) | N/A |
| Software and algorithms | ||
| Prism | Graphpad | https://www.graphpad.com/scientific-software/prism/ |
| R studio | RStudio | https://www.rstudio.com/ |