Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Immunofluorescence probes and primers
| Loci | Sequence (5′–3′) | |
|---|---|---|
| rs1800817 | Upstream primer | GGGCTGGTTCTTCATTCATTACCTT |
| Downstream primer | TGCAAGGGTCCAAAGTTCACT | |
| Probe 1 | CCCCCACCTTCTG | |
| Probe 2 | CCCCCCCCTTCTG | |
Note: rs2285094 probes and primers: Assay ID C_15962706_10, Thermo Fisher Scientific. The mutation sites of rs1800817 are underlined in the sequence of the Prob1 and 2.
