| Gene | Guide Number | Sequence | Catalog Number |
|---|---|---|---|
| MB21D1 (cGAS) | 1 | TTGAATGCGCAGGCCTTCTT | CM-015607–01 |
| MB21D1 (cGAS) | 2 | CTGGGTACATACGTGAAAGA | CM-015607–02 |
| MB21D1 (cGAS) | 3 | GAACTTTCCCGCCTTAGGCA | CM-015607–03 |
| MB21D1 (cGAS) | 4 | CCGCGATGATATCTCCACGG | CM-015607–04 |
| MB21D1 (cGAS) | 5 | GCATCCCTCCGTACGAGAAT | CM-015607–05 |
| NONO (4841) | 2 | GTTTATGCCCATAGCACCTA | CM-007756–02 |
| NONO (4841) | 5 | ATGGGAGATATACCGCATCA | CM-007756–05 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.