Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
List of intron spanning human oligonucleotide primers used in this study.
| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| FcεRI α subunit | gttagcagtccctcagaaacc | ctgccattgtggaaccatttg |
| FcεRI β subunit FcεRI γ subunit Glyceraldegyde-3-phosphate dehydrogenase (GapDH) |
aaatcttgctctcccacagg actgaagatccaagtgcgaaag agccacatcgctcagacac |
ggatgaggccgacttcaatag agtctcgtaagtctcctggttc gcccaatacgaccaaatcc |
