| Reagent/Resource | Reference or Source | Identifier or Catalog Number |
|---|---|---|
| Experimental Models | ||
| C57BL/6NCrl (Mus Musculus) | SLC | N/A |
| SJL/J (Mus Musculus) | Charles River | N/A |
| Atf3:BAC Tg (Mus Musculus) | Kiryu‐Seo et al (2016) | N/A |
| Atf3:BAC2 Tg (Mus Musculus) | This paper | N/A |
| Rpt3‐flox (Mus Musculus) | Tashiro et al (2012) | N/A |
| B6SJL‐Tg(SOD1*G93A)1Gur/J (Mus Musculus) | The Jackson Laboratory | JAX stock # 002726; RRID: IMSR_JAX:002726 |
| B6.Cg‐Tg(Thy1‐CFP/COX8A)S2Lich/J (Mus Musculus) | The Jackson Laboratory | IMSR Cat# JAX:007967, RRID:IMSR_JAX:007967 |
| COS‐7 cell | ATCC | Cat# CRL‐1651 |
| Recombinant DNA | ||
| Unmodified BAC clone | The BACPAC Resources Center at the Children's Hospital Oakland Research Institute | RP24‐318C6 |
| Rat AnkG (1‐438, 439‐837, 838‐1156, 1157‐1476, 1477‐1908, 1909‐2325, 2326‐2622 aa.) in pEF‐BOS‐GST | This paper | N/A |
| HA‐Ubiquitin in pcDNA3 | Addgene | Addgene plasmid 18712 |
| MitoGFP‐ires‐Cre in pL451 | Kiryu‐Seo et al (2016) | N/A |
| Antibodies | ||
| Rabbit anti‐GFP polyclonal (1:1,000) | MBL | Cat# 598, RRID:AB_591819 |
| Rat anti‐GFP monoclonal (1:1,000) | Nacalai Tesque | Cat# 04404‐84, RRID:AB_10013361 |
| Rabbit anti‐Ank‐G (Ankirin‐G) polyclonal (1:500) | Frontier Institute | Cat# AnkG‐Rb, RRID:AB_2571661 |
| Mouse anti‐Ankyrin G Monoclonal (4G3F8) (1:300) | Thermo Fisher Scientific | Cat# 33‐8800, RRID:AB_2533145 |
| Rabbit anti‐RPT3 polyclonal (1:500) | Enzo Life Sciences | Cat# BML‐PW8175, RRID:AB_10541231 |
| Rabbit anti‐TARDBP polyclonal (1:500) | Proteintech | Cat# 10782‐2‐AP, RRID:AB_615042 |
| Mouse anti‐TARDBP monoclonal (1:500) | Novus | Cat# NBP1‐92695, RRID:AB_11005586 |
| Guinea pig anti‐p62 polyclonal (1:500) | Progen | Cat# GP62‐C, RRID:AB_2687531 |
| Goat anti‐ECEL1 (N‐20) polyclonal (1:1,000) | Santa Cruz Biotechnology | Cat# sc‐11338, RRID:AB_2097871 |
| Mouse anti‐NeuN monoclonal (1:1,000) | Millipore | Cat# MAB377, RRID:AB_2298772 |
| Rabbit anti‐ATF‐3 (C‐19) polyclonal (1:1,000) | Santa Cruz Biotechnology | Cat# sc‐188, RRID:AB_2258513 |
| Rabbit anti‐ATF3 monoclonal (1:1,000) | Abcam | Abcam Cat# ab207434, RRID:AB_2734728 |
| Goat anti‐ChAT polyclonal (1:1,000) | Millipore | Cat# AB144P, RRID:AB_2079751 |
| Rabbit anti‐ChAT polyclonal (1:5,000) | Ichikawa et al (1997) | |
| Rabbit anti‐Iba1 polyclonal (1:1,000) | Wako | Cat# 019‐19741, RRID:AB_839504 |
| Goat anti‐GFAP polyclonal (1:1,000) | Abcam | Cat# ab53554, RRID:AB_880202 |
| Rabbit anti‐Caspr polyclonal (1:1,000) | Abcam | Cat# ab34151, RRID:AB_869934 |
| Mouse anti‐Neurofilament H monocolonal (1:1,000) | Covance | Cat# SMI‐32P‐100, RRID:AB_10719742 |
| Mouse anti‐cytochrome c monoclonal (1:500) | Thermo Fisher Scientific | Cat# 45‐6100, RRID:AB_2533821 |
| Goat anti‐MMP‐9 polyclonal (1:1,000) | Sigma‐Aldrich | Cat# M9570, RRID:AB_1079397 |
| Goat anti‐Osteopontin polyclonal (1:1,000) | R and D Systems | Cat# AF808, RRID:AB_2194992 |
| Rat ant‐Lamp‐1 monoclonal (1:1,000) | Santa Cruz Biotechnology | Cat# sc‐19992, RRID:AB_2134495 |
| Mouse anti‐GAPDH Monoclonal (6C5) (1;5,000) | Thermo Fisher Scientific | Cat# AM4300, RRID:AB_2536381 |
| α‐Bungarotoxin, Alexa Fluor™ 594 conjugate (1:300) | Thermofisher | B13423 |
| GST‐Tag Polyclonal (1:1,000) | MBL | Cat# PM013, RRID:AB_591789 |
| Mouse Anti‐HA.11 Monoclonal (1:1,000) | Covance | Cat# MMS‐101P‐1000, RRID:AB_291259 |
| Alexa Donkey anti‐rat 488 (1:500) | Thermo Fisher Scientific | Cat# A‐21208, RRID:AB_2535794 |
| Alexa Donkey anti‐rabbit 488 (1:500) | Thermo Fisher Scientific | Cat# A‐21206, RRID:AB_2535792 |
| Alexa Donkey anti‐rabbit 594 (1:500) | Thermo Fisher Scientific | Cat# A‐21207, RRID:AB_14163 |
| Alexa Donkey anti‐mouse 594 (1:500) | Thermo Fisher Scientific | Cat# A‐21203, RRID:AB_141633 |
| Alexa Donkey anti‐goat 647 (1:500) | Thermo Fisher Scientific | Cat# A‐21447, RRID:AB_2535864 |
| Alexa Goat anti‐rat 488 (1:500) | Thermo Fisher Scientific | Cat# A‐11006, RRID:AB_2534074 |
| Alexa Goat anti‐rabbit 594 (1:500) | Thermo Fisher Scientific | Cat# A‐11012, RRID:AB_2534079 |
| Alexa goat anti‐mouse 594 (1:500) | Thermo Fisher Scientific | A‐11005, RRID:AB_2534073 |
| Alexa goat anti‐guina pig 594 (1:500) | Thermo Fisher Scientific | Cat# A‐11076, RRID:AB_2534120 |
| Oligonucleotides and sequence‐based reagents | ||
| See Appendix Table S1 | ||
| Chemicals, enzymes and other reagents | ||
| ECL™ Prime Western Blotting System | Amersham | Cat# RPN2232 |
| SuperSepTMAce | WAKO | Cat# 197‐15011 |
| RNeasy lipid tissue midi kit | QIAGEN | Cat# 74804 |
| SuperScript® III RNase H‐Reverse Transcriptase | Invitrogen | Cat# 18080‐085 |
| CUBIC‐L | Tokyo Chemical Industry Co., Ltd. | Cat# T3740 |
| CUIBC‐R | Tokyo Chemical Industry Co., Ltd. | Cat# T3741 |
| Mounting solution | Tokyo Chemical Industry Co., Ltd. | Cat# M3294 |
| Fast SYBRTM Green Master Mix | Thermo Fisher Scientific | Cat# 4385616 |
| Software | ||
| Fiji | Image J | Fiji NIH http://fiji.sc/ |
| GraphPad Prism version7.0 | Graphpad Software | GraphPad Prism version 7.0 GraphPad Software, Inc https://www.graphpad.com/scientificsoftware/ |
| Imaris | Bitplane | Bitplane |
| Zen black and blue | Carl Zeiss | Zeiss |
| Other | ||
| AAV9‐AnkG shRNA‐mCherry ‐ shRNA sequence 5'‐GCGTCTCCTATTAGATCTTTC‐3′ | Vector builder | N/A |
| AAV9‐scramble shRNA | Vector builder | N/A |
| Fv10i | Olympus | |
| Lightsheet 7 | Carl Zeiss | |
| SpinSR | Olympus | |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.