KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Goat polyclonal anti-CD163 | R&D Systems | Cat#AF1607 |
| Mouse monoclonal anti-actin beta (clone 8H10D10) | Cell Signaling Technology | Cat#3700S |
| Donkey anti-goat IgG (H+L) HRP conjugate | Thermo Fisher Scientific | Cat#A16005 |
| Anti-mouse IgG (H+L) HRP conjugate | Promega | Cat#W402B |
| Mouse purified monoclonal anti-CD163 (clone GHI/61) | BioLegend | Cat#333609 |
| Rabbit polyclonal anti-occludin | Thermo Fisher Scientific | Cat#71-150-0 |
| Goat anti-mouse IgG AF488+ | Invitrogen | Cat#A32723 |
| Goat anti-rabbit IgG AF546 | Invitrogen | Cat#A11010 |
| Bacterial and virus strains | ||
| Simian hemorrhagic fever virus (SHFV) isolate LVR42–0/M6941 | American Type Culture Collection (ATCC) | Cat#VR-533 |
| Ebola virus/H.sapiens-wt/GIN/2014/Makona-C05 | Gary Kobinger (Public Health Agency Canada) | N/A |
| Biological samples | ||
| Rhesus macaque peripheral blood mononuclear cells (PBMCs) | G. K. Wilkerson, The University of Texas MD Anderson Cancer Center | N/A |
| Human PBMCs | Lonza | Cat#4W-270A |
| Nancy Ma’s night monkey (Aotus nancymaae) PBMCs | G. K. Wilkerson | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| Human recombinant macrophage colony-stimulating factor (M-CSF) | R&D Systems | Cat#216-MC-010 |
| Interferon-Y (IFN-γ) | R&D Systems | Cat#285-IF |
| Interleukin 4 (IL-4) | MilliporeSigma | Cat#H7291 |
| Polybrene hexadimethrine bromide | MilliporeSigma | 107689–10G |
| 5-propargylamino-2’,3’-dideoxyuridine-5’-triphosphate (ddUTP) ATTO 633 | Jena Bioscience | Cat#NU-1619–633 |
| Cas9 nuclease, S. pyogenes | New England Biolabs (NEB) | Cat#M0386M |
| Eagle’s minimum essential medium (EMEM) | ATCC | 30–2003 |
| 10% fetal bovine serum (FBS) | MilliporeSigma | TMS-013-B |
| 1X penicillin-streptomycin solution (Pen Strep) | Avantor | #45000–652 |
| RPMI-1640 medium | ATCC | #30–2001 |
| Dulbecco’s modified Eagle’s medium (DMEM) | MilliporeSigma | #D6429 |
| L-glutamine | Corning Incorporated | #MT25005CI |
| Hygromycin | Corning Incorporated | #30–240-CR |
| Phosphate-buffered saline (PBS) | Caisson Labs | PBL01–6X500ML |
| ImmunoCult-SF macrophage medium | STEMCELL Technologies | #10961 |
| 1X phenol-free EMEM | VWR | #115-073-101 |
| 1.4% Avicel | FMC Corporation | RC-591 NF |
| 10% neutral buffered formalin | MilliporeSigma | #HT501128–4L |
| 0.2% crystal violet | MilliporeSigma | #C3866–25G |
| Lipofectamine 3000 reagent | Thermo Fisher Scientific | #L3000008 |
| Opti-MEM | Thermo Fisher Scientific | #31985–070 |
| Tragacanth | MilliporeSigma | #G1128 |
| Nonidet P-40 buffer (NP-40) | Promega | #V4221 |
| Tris(hydroxymethyl)aminomethane hydrochloride (HCl) pH 7.4 | Teknova | #T1075 |
| 1% NP-40 | G-Biosciences | #DG001 |
| Dithiothreitol (DTT) | IBI Scientific | #IB21040 |
| Benzonase | MilliporeSigma | #E1014 |
| Protease inhibitor mixture | MilliporeSigma | #11873580001 |
| Ethylenediamine tetraacetic acid (EDTA) | Corning Incorporated | #25–052-CI |
| 10% Tris-glycine eXtended (TGX) stain-free acrylamide premixed gel solution | Bio-Rad | #1610182 |
| 0.1% tris-buffered saline (TBS) | Research Products International (RPI) | #T60075–4000.0 |
| Polysorbate 20 | Amresco | #M147–1L |
| Nestle Carnation 5% nonfat dried milk | Vevey | N/A |
| Enhanced chemiluminescent (ECL) reagent | MilliporeSigma | #GERPN2232 |
| Neon Transfection System Kit | Thermo Fisher Scientific | #MPK10025 |
| T7 endonuclease 1 (E1) assay in the Alt-R Genome Editing Detection Kit | Integrated DNA Technologies (IDT) | #1075931 |
| Phusion high-fidelity polymerase chain reaction (PCR) master mix with buffer | NEB | #M0531L |
| Clontech pLHCX retroviral expression vector | Takara Bio Inc. | #631511 |
| TransIT 293 transfection reagent | Mirus Bio | #MIR2705 |
| 4% PFA | VWR | #100504–858 |
| FACS buffer | MilliporeSigma | #324506–100ML |
| Terminal deoxynucleotidyl transferase (TdT) buffer | Thermo Fisher Scientific | #EP0161 |
| Sodium acetate (NaOAc) | Amresco | #E498–200ML |
| 100% cold ethanol (EtOH) | Thermo Fisher Scientific | # 04-355-223 |
| Nuclease-free water | IBI Scientific | # IB42201 |
| Poly-L-lysine | MilliporeSigma | #P8920 |
| Paraformaldehyde (PFA) | VWR | #100504–85 |
| 0.1% Triton X-100 | VWR | #JTX198–5 |
| Wash Buffer A | Biosearch Technologies | #SMF-WA1–60 |
| Hybridization buffer | Biosearch Technologies | #SMF-HB1–10 |
| Hoechst 33342 dye for DNA and nuclei | Invitrogen | #H3570 |
| Wash Buffer B | Biosearch Technologies | #SMF-WB1–20 |
| Prolong Gold Antifade Mountant with 4’,6-diamidino-2-phenylindole (DAPI) | Thermo Fisher Scientific | #P36941 |
| 10% neutral buffered formalin | VWR | #16004–128 |
| Critical commercial assays | ||
| Bicinchoninic acid (BCA) protein assay | Thermo Fisher Scientific | Cat#23227 |
| Alt-R Genome Editing Detection Kit | IDT | Cat#1075931 |
| TOPO TA cloning kit | Thermo Fisher Scientific | Cat#K457501 |
| Cytofix/cytoperm Fixation/Permeabilization solution kit | BD | Cat#554714 |
| Data and code availability | ||
| CD163 receptor orthologs cloned from nonhuman primate biomaterial | This study | GenBank IDs: MZ695198–MZ695214 |
| Pearson correlation coefficient analysis | Peters and Garcea, 2020 | https://github.com/DouglasPeters/GarceaMatLabAnalyses/blob/52257dea52d610218b7b9b8b7b43818de67f72de/SIM_ColocalizationandCovarianceAnalysis_08152019_CURRENT.m |
| Experimental models: Cell lines | ||
| MA-104 Clone 1 | ATCC | Cat#CRL-2378.1 |
| MA-104 subclone MARC-145 | Kay Faaberg, U.S. Department of Agriculture | N/A |
| COS-7 | ATCC | Cat#CRL-1651 |
| Patas monkey skin fibroblasts | Coriell Institute for Medical Research (CIMR) | Cat#AG06254 and AG06116 |
| Human histiocytic SU-DHL-1 | ATCC | Cat#CRL-2955 |
| Monocytic THP-1 | ATCC | TIB-202 |
| Monocytic U937 | ATCC | Cat#CRL-1593.2 |
| Kidney cell line ACHN | NCI-Frederick Cancer DCTD Tumor/Cell Line Repository | N/A |
| Kidney cell line CAKI-1 | NCI-Frederick Cancer DCTD Tumor/Cell Line Repository | N/A |
| Kidney cell line786–0 | NCI-Frederick Cancer DCTD Tumor/Cell Line Repository | N/A |
| Kidney cell line A498 | NCI-Frederick Cancer DCTD Tumor/Cell Line Repository | N/A |
| HEK293T | ATCC | Cat#11268 |
| Grivet kidney Vero E6 | ATCC | Cat#CRL-1586 |
| MA-104, Vero, patas monkey, human bone marrow | Takara Bio Inc. | #636643 |
| Common chimpanzee (Pan troglodytes) fibroblasts | Emory University | S008886 |
| Red-cheeked gibbon (Nomascus gabriellae) fibroblasts | CIMR | #PR00381 |
| Northern white-cheeked gibbon (Nomascus leucogenys) fibroblasts | CIMR | #PR00712 |
| Lar gibbon (Hylobates lar) fibroblasts | CIMR | #PR01131 |
| Collared mangabey (Cercocebus torquatus) fibroblasts | CIMR | #PR00485 |
| Black crested mangabey (Lophocebus aterrimus) fibroblasts | CIMR | #PR01215 |
| Angolan talapoin (Miopithecus talapoin) fibroblasts | CIMR | #PR00716 |
| Wolf’s mona monkey (Cercopithecus wolfi) fibroblasts | CIMR | #PR01241 |
| Francois’ langur (Trachypithecus francoisi) fibroblasts | CIMR | #PR01099 |
| Mantled guereza (Colobus guereza) fibroblasts | CIMR | #PR00980 |
| Bolivian red howler (Alouatta sara) fibroblasts | CIMR | #PR00708 |
| Oligonucleotides | ||
| Primers for cloning nonhuman primate CD163 receptor orthologs | See Table S1 for primer sequences | N/A |
| CRISPR-Cas9 RNA (crRNA) targeting CD163 exon 3; AATGCGTCCAGAACCTGCAC | This study | N/A |
| Alt-R trans-activating CRISPR-Cas9 RNA (tracrRNA) | IDT | Cat#1072534 |
| Recombinant DNA | ||
| pLHCX retroviral transfer vector encoding CD163 orthologs | This study | N/A |
| Empty pLHCX retroviral transfer vector | Yamashita and Emerman, 2004 | N/A |
| pCS2-mGP encoding MLV gag-pol | Yamashita and Emerman, 2004 | N/A |
| pCMV-VSV-G (encoding vesicular stomatitis Indiana virus glycoprotein “G” | Addgene | Cat#8454 |
| Recombinant SHFV (rSHFV) | Cai et al., 2021 | N/A |
| Enhanced green fluorescent protein-expressing rSHFV | Cai et al., 2021 | N/A |
| Software and algorithms | ||
| Sequencher DNA sequence analysis software | Gene Codes Corporation | N/A |
| Stellaris probe designer | Biosearch Technologies | https://www.biosearchtech.com/support/tools/design-software/stellaris-probe-designer |
| ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ |
| FlowJo v10.8.0 software | BD Life Sciences | N/A |
| MEGA7 | Kumar et al., 2016 | https://www.megasoftware.net/ |
| MEGAX | Stecher et al., 2020 | https://www.megasoftware.net/ |
| PAL2NAL web server tool | Suyama et al., 2006 | http://www.bork.embl.de/pal2nal/ |
| Nipot v2.3 | Perriere and Gouy, 1996 | http://doua.prabi.fr/software/njplot |
| PAML4.8 | Yang, 2007 | N/A |
| Prism v9.1.0 | GraphPad | N/A |
| QGIS v3.16.4 | QGIS Geographic Information System | www.qgis.org |
| BioRender | Created with Biorender.com | N/A |