Table 1.
Sequence of mutagenesis template, sgRNA targeted site and polymerase chain reaction primers
| Name | Sequence |
|---|---|
| ssONDa | cctctctaactttctgtttttggtaataggacatctccaagtttgcagagaaggacaatatcgtccttggagaaggtggaatcacactgagtggTgATcagcgagcaagaatttccttagcaaggtgaatatcccattattggttcagcgagcatttgttgtaaatatcatgcatgtaaaaattatagacat |
| gRNA-G551Db | gaaggtggaatcacact//gagTGG |
| gRNA-S66b | gcggctgaagcactgca//cgcCGG |
| HR-Fw | aggcgcccctggagatttcc |
| Fw1 | catggtcatgaaggacattc |
| Rev | aactaggaagtagaagcagaagc |
| G551DtgTw | aacagttcctctctaactttctg |
| G551DtgRev | cgaggcatttttcagtttcag |
a
The oligo mutagenesis template: Upper case indicates the nucleotides different from the original wild-type allele, bold fonts are the D551 codon and underlined nucleotides indicate the BclI site created in the HR template for easy genotypic assay of the G551D mutation.
b
Cas9/gRNA complex targeted DNA sequences with the PAM in ferret CFTR locus or integrated EGFPY66S in ferret genome: upper cases are the PAM, // mark the cleavage site.
CFTR, cystic fibrosis transmembrane conductance regulator; EGFP, enhanced green fluorescent protein; HR, homologous recombination; PAM, protospacer adjacent motif; ssOND, single stranded DNA oligonucleotides.