Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequencing primers used to confirm the sequence of tetherin clones and modified tetherin constructs inserted into plasmid vectors
| Primer | Sequence (5′ > 3′) | Direction | Target region |
|---|---|---|---|
| M13F | GTAAAACGACGGCCAG | Forward | pCR-Blunt-II-TOPO vector |
| M13R | CAGGAAACAGCTATGAC | Reverse | pCR-Blunt-II-TOPO vector |
| T7F | TAATACGACTCACTATAGGG | Forward | pcDNA3.1 vector |
| BGHR | TAGAAGGCACAGTCGAGG | Reverse | pcDNA3.1 vector |
