Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers
| Primer | Sequence |
|---|---|
| VprTGA a | ctggcatttgggtcagggagtc |
| VprTGA b | cagggctctagttcaggatctactggctc |
| VprTGA c | gagccagtagatcctgaactagagccctg |
| VprTGA d | gttctcttaatttgctagc |
| CA A14BssHII fwd 1 | cttgctgaagcgcgca |
| CA A14TAG rev 1 | agttctaggtgatatctactgatgtaccatttg |
| CA A14TAG fwd 2 | caaatggtacatcagtagatatcacctagaact |
| CA A14ApaI rev 2 | gccctgcaatttttggctatgtg |
