Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Information of the two SNP markers for selecting the seed coat and aleurone layers as HRM PCR markers.
| Gene | SNP Position (bp) | Allele | Oligo Name | Sequence (5′→3′) | Tm (°C) | Product Size |
|---|---|---|---|---|---|---|
| TA2 | S1_6444737 | C/T | TA2S1-737-Fw | CACGGAAACCCAAGAAGAAA | 60 | 175 bp |
| TA2S1-737-Rv | GCCTGTTCTGCAGGAGGTT | 60 | ||||
| S1_6445148 | A/C | TA2S1-148-Fw | TGCACATTTGTTTCCTCCTG | 60 | 225 bp | |
| TA2S1-148-Rv | TGCGTCTGACTGATTGAACTG | 60 |
