Coniochaeta massiliensis sp. nov. Isolated from a Clinical Sampl28

Abstract

The genus Coniochaeta belongs to the class Ascomycota and the family Coniochaetaceae. Some of the Coniochaeta species are plant and animal pathogens, while others are known to be primarily involved in human diseases. In the last few decades, case reports of human infections with Coniochaeta have increased, mainly in immunocompromised hosts. We have described and characterised a new species in the genus Coniochaeta, here named Coniochaeta massiliensis (PMML0158), which was isolated from a clinical sample. Species identification and thorough description were based on apposite and reliable phylogenetic and phenotypic approaches. The phylogenetic methods included multilocus phylogenetic analyses of four genomic regions: ITS (rRNA Internal Transcribed Spacers 1 and 2), TEF-1α (Translation Elongation Factor-1alpha), B-tub2 (β-tubulin2), and D1/D2 domains (28S large subunit rRNA). The phenotypic characterisation consisted, first, of a physiological analysis using both EDX (energy-dispersive X-ray spectroscopy) and Biolog^TM advanced phenotypic technology for fixing the chemical mapping and carbon-source oxidation/assimilation profiles. Afterwards, morphological characteristics were highlighted by optical microscopy and scanning electron microscopy. The in vitro antifungal susceptibility profile was characterised using the E-test^TM exponential gradient method. The molecular analysis revealed the genetic distance between the novel species Coniochaeta massiliensis (PMML0158) and other known taxa, and the phenotypic analysis confirmed its unique chemical and physiological profile when compared with all other species of this genus.

1. Introduction

Coniochaeta spp. are pleomorphic ascomycetous fungi belonging to the family Coniochaetaceae [1]. Some of these yeasts are also classified within dematiaceous fungi due to the presence of melanin in cell walls, known for emitting dark pigments in culture, which is perceived as a virulence factor [2]. Coniochaeta species are ubiquitously distributed in the environment. They have been isolated from several natural substrates, including soil [3,4], wood [5], plants [6], water [7], and food [8]. The previously given name Coniochaeta has been retained for the Lecythophora genus, following the “one fungus, one name” nomenclature change in January 2013. Therefore, all six species of the Lecythophora genus (L. decumbens, L. fasciculata, L. hoffmannii, L. lignicola, L. luteoviridis, and L. mutabilis) were transferred to the Coniochaeta genus [9,10]. C. hoffmannii and C. mutabilis are considered the most frequent species of the Coniochaeta genus found in clinical samples. These yeasts are known to be human pathogens, causing invasive fungal infections, occasionally with fatal outcomes, particularly in immunocompromised patients [11]. C. hoffmannii has been described as a plant pathogen [12]. It has also been implicated in emerging human fungal infections, including subcutaneous abscess [12], keratitis [13], and sinusitis [14], and in canine osteomyelitis in a dog [15]. However, Coniochaeta mutabilis [12] is known to be more frequently involved in severe infections. It has been involved in human peritonitis [16], endocarditis [17,18], septic shock [19], endophthalmitis [20,21], and keratomycosis [22]. The present study aimed to properly describe and characterise, genetically and phenotypically, a new species of Coniochaeta isolated from a human abscess.

2. Materials and Methods

2.1. Fungal Strains

The phenotypic features of Coniochaeta massiliensis PMML0158 were compared with those of two reference strains, C. mutabilis DSM 10716 and C. hoffmannii DSM 2693. The genotypic characteristics of these three strains were also compared with those of seven other reference strains in the genus Coniochaeta, including C. fasciculate CBS 205.38, C. lignicola CBS 267.33, C. luteoviridis CBS 206.38, C. hoffmannii CBS 245.38, C. mutabilis CBS 157.44, C. lignaria DWS9m2/SMH2569/95.605, and C. cateniformis UTHSC 01-1644. Phialemonium obovatum CBS 279.76 was used as an outgroup in the phylogenetic analyses.

2.2. Macroscopic Characterisation

The temperature growth profiles and macroscopic features, including colony time of growth, aspect, and surface/reverse colour, for all strains were determined with five-day-old colonies cultivated on Sabouraud Dextrose Agar (SDA) plates supplemented with Gentamycin and Chloramphenicol (GC). Colonies were inoculated on other, new plates of SDA GC at 4, 25, 30, 33, 37, 40, and 45 °C.

2.3. Microscopic Characterisation

Microscopic features were first analysed with optical microscopy. Microscopic slides were prepared using the cellophane adhesive-tape method with lactophenol cotton blue (LCB). Photographs were taken with the DM 2500 (LEICA CAMERA SARL, Paris, France) camera. Further observation was performed using scanning electron microscopy. A fragment of fungal colonies was fixed on a microscope slide with 400 μL of glutaraldehyde 2.5% in 0.1 M sodium cacodylate buffer and stored at 30 °C for at least 30 min. Photographs were taken with the TM4000 Plus microscope (Hitachi High-Technologies, Tokyo, Japan) adjusted to 15 KeV lens mode 4 with a back-scattered electron detector (BSE).

2.4. MALDI-TOF MS Identification

The fungi were incubated on SDA GC at 30 °C for five to eight days. Once grown, colonies were identified with matrix-assisted laser desorption/ionization–time of flight mass spectrometry (MALDI-TOF MS), using the procedure described in Cassagne et al. (2016) [23]. The Microflex LT^TM instrument and the MALDI Biotyper^TM system (Bruker Daltonics GmbH, Bremen, Germany) were used, along with the manufacturer’s and in-house reference spectra databases, as described in Normand et al. (2017) [24].

2.5. Antifungal Susceptibility Testing (AFST)

The in vitro sensitivity of nine antifungal drugs was tested against the three Coniochaeta strains using the Sensititre YeastOne^TM (Thermo Fisher Scientific, Dardilly, France) microdilution system, following the supplier’s recommendations. Briefly, isolates were grown on SDA GC until maturity, the inoculum was suspended in 2 mL of saline, and turbidity was adjusted to 0.5 McFarland, to obtain an inoculum of ~1.5 × 10⁸ CFU/mL. Next, 20 µL of this solution was added to 10 mL of YeastBroth^TM (Thermo Fisher Scientific, Illkirch, France) before 100 µL of this final solution was transferred into each Sensititre YeastOne^TM YO09 (Thermo Fisher Scientific) plate well. MICs were read after 48 h incubation at 35 °C.

2.6. Physiological Analyses

2.6.1. Energy-Dispersive X-ray Spectroscopy (EDX) Analysis

Fresh cultures of the three strains were fixed in 1 mL of 2.5% Glutaraldehyde in 0.1 M Sodium Cacodylate buffer for at least 1 h. A cytospin was performed with 200 μL of the fixed fungal solution and centrifugation at 800 rpm for eight minutes. EDX was achieved with an INCA X-Stream-2 detector (Oxford Instruments) associated with TM4000 Plus scanning electron microscopy and AztecOne software (Oxford Instruments, Pasadena, CA, USA). The chemical mapping was performed blindly and took into consideration all chemical elements. The results for the weights and atomic percentages of chemical elements for each strain were subjected to principal component analysis with the XLSTAT (Addinsoft, Paris, France) software.

2.6.2. Biolog^TM Phenotypic Analysis

Biolog’s advanced phenotypic technology was used for the phenotypic analysis. YT MicroPlates^TM (Gen III) (Biolog catalogue no. 1005) were used for oxidation tests and carbon-source assimilation. The selected carbon sources can discriminate between the different profiles of fungal phenotypes [25]. The 96-well YT MicroPlate^TM contains a patented Redox tetrazolium dye that changes colour when cellular respiration occurs, conferring a metabolic fingerprint. All strains were cultivated on Biolog Universal Yeast^TM (BUY) Agar medium (Biolog catalogue no. 70005). Colonies must be fresh and well-developed. Incubation time depends on the genus. For Coniochaeta spp., maximal growth was observed after four to six days of incubation. A fungal suspension was prepared by swabbing some conidia into YT Inoculating Fluid^TM (Biolog catalogue no. 72501) adjusted to a 47% transmittance level with the Biolog Turbidimeter^TM (Biolog catalogue no. 3587). Then, 100 μL of this suspension was pipetted into each YT MicroPlates^TM well. The plates were incubated at 26 °C for one week. The results are shown in the form of a heat map generated by XLSTAT.

2.7. DNA Extraction and Sequencing

After five days of incubation on SDA GC at 30 °C, DNA was extracted from the fungal colonies with the Qiagen^TM Tissue kit after mechanical lysis using the FastPrep^TM-24 instrument in bead tubes with G2 lysis buffer (provided with the Qiagen^TM Tissue kit). The extraction was performed with the EZ1 Advanced XL^TM instrument, following the manufacturer’s instructions.

Four genomic regions were amplified: the rRNA internal transcribed spacers 1 and 2 (ITS1-2), a fragment of the β-tubulin gene (B-tub2), a fragment of the translation elongation factor 1-alpha gene (TEF-1-α), and the D1/D2 domains of the rRNA large subunit (LSU) (Table 1). PCR mixes included 5 μL of DNA extract to 20 μL of mix (12.5 μL ATG (Ampli Taq Gold^TM 360 Master Mix, Applied Biosystems), 6 μL sterile water (DNase/RNase-free), 0.75 μL forward/reverse primer) to a total volume of 25 μL/well. The PCR program for all gene amplifications was as follows: an initial denaturation step at 95 °C for 15 min, followed by 39 cycles of: 1 min denaturation at 95 °C, 30 s annealing at 56 °C, 1 min extension at 72 °C, and a final 5 min extension at 72 °C. The amplicons were visualized on 2% agarose gel with Sybr Safe DNA^TM gel stain (Invitrogen, Waltham, MA, USA) using the Safe Imager 2.0 Blue-Light Transilluminator^TM (Invitrogen). Sequencing was performed on a 3500 Genetic Analyser^TM (Applied Biosystems, Inc.). The sequences were assembled and corrected using Chromas Pro 2.0 and analysed using the BLASTn tool with the reference data available from the GenBank database of the National Center for Biotechnology Information (NCBI).

Table 1.

Sets of primers used for amplifying the ITS, B-tub2, TEF1, and D1/D2 genetic regions.

Primers	Sequences	Targeted Regions	References
ITS1	TCCGTAGGTGAACCTGCGG	18S-5.8S	[26]
ITS2	GCTGCGTTCTTCATCGATGC	18S-5.8S	[26]
ITS3	GCATCGATGAAGAACGCAGC	5.8S-28S	[26]
ITS4	TCCTCCGCTTATTGATATGC	5.8S-28S	[26]
ITS1	TCCGTAGGTGAACCTGCGG	18S-5.8S, 5.8S-28S	[26]
ITS4	TCCTCCGCTTATTGATATGC	18S-5.8S, 5.8S-28S	[26]
Bt-2a	GGTAACCAAATCGGTGCTGCTTTC	B-tub2	[27]
Bt-2b	ACCCTCAGTGTAGTGACCCTTGGC	B-tub2	[27]
EF1-728F	CATCGAGAAGTTCGAGAAGG	TEF1	[28]
EF1-986R	TACTTGAAGGAACCCTTACC	TEF1	[28]
D1	AACTTAAGCATATCAATAAGCGGAGGA	28S	[11]
D2	GGT CCG TGT TTC AAG ACG G	28S	[11]

2.8. Phylogenetic Analyses

Five phylogenetic trees were built. The first one was a multilocus tree constructed after concatenating the ITS, B-tub2, and D1/D2 nucleotide sequences of the clinical isolate, two reference strains, and sequences of other Coniochaeta species obtained from the GenBank database. The four other trees were each built with only one locus and included several Coniochaeta species also collected from GenBank database (accession numbers are detailed in Table 2). All sequences were aligned with Muscle (a tool available in MEGA 11 software). Phialemonium obovatum CBS 279.76 was used as the outgroup. The maximum-parsimony phylogenetic trees were constructed with the default settings and branch-robustness estimation was tested using 1000 bootstrap replications with the molecular evolutionary genetics analysis (MEGA) software version 11.

Table 2.

GenBank accession numbers of the reference strains used for the phylogenetic analyses.

Species	Collection ID	GenBank Accession Numbers
		ITS	B-tub2	D1/D2	TEF1
Coniochaeta massiliensis	PMML0158	OM366153	ON000097	OM366268	OM640093
Coniochaeta mutabilis	DSM 10716	OM366154	ON000098	OM366269	OM640094
Coniochaeta hoffmannii	DSM 2693	OM366155	ON000099	OM366270	OM640095
Coniochaeta fasciculata	CBS 205.38	HE610336	HE610350	FR691988	MK693152
Coniochaeta lignicola	CBS 267.33	HE610335	HE610353	FR691986	MK693154
Coniochaeta luteoviridis	CBS 206.38	HE610333	HE610351	FR691987	NA *
Coniochaeta hoffmannii	CBS 245.38	HE610332	HE610352	FR691982	MK693150
Coniochaeta mutabilis	CBS 157.44	HE610334	HE610349	AF353604	NA
Coniochaeta lignaria	DWS9m2/SMH2569/95.605	KJ188673	AY780113	AF353584	NA
Coniochaeta cateniformis	UTHSC 01-1644	HE610331	HE610347	HE610329	NA
Coniochaeta decumbens	CBS 153.42	HE610337	HE610348	HE610463	NA
Coniochaeta velutina	CBS 121444	NA	NA	GQ154605	NA
Coniochaeta velutina	STEU 8315	KY312638	NA	NA	NA
Coniochaeta simbalensis	NFCCI 4236	MG825743	NA	NG_068555	NA
Coniochaeta fodinicola	YoF/CBS 136963	JQ904607	NA	NG_064287	NA
Coniochaeta prunicola	CBS 120875	GQ154540	NA	NG_066151	NA
Coniochaeta prunicola	STE-U 6107	NA *	NA	NA	MK693162
Coniochaeta africana	CBS 120868	GQ154539	NA	NG_066150	NA
Coniochaeta palaoa	ARIZ AEASO06001	MZ241149	NA	NA	NA
Coniochaeta palaoa	ARIZ AEANC0604	MK458764	NA	NA	MZ241188
Coniochaeta marina	MFLUCC 18-0408	MF422164	NA	NA	NA
Coniochaeta cipronana	PL5-2C	MG828883	NA	NA	NA
Coniochaeta rosae	MFLUCC/17-0810	MG828880	NA	NA	MG829197
Coniochaeta rosae	TASM 6127	NA	NA	NG_066204	NA
Coniochaeta baysunika	MFLUCC/17-0830	MW750761	NA	MG828996	MG829196
Coniochaeta acaciae	CX37	MW750756	NA	NA	NA
Coniochaeta acaciae	MFLUCC 18-0776	NA	NA	NA	MT503199
Coniochaeta acaciae	MFLUCC 17-2298	NA	NA	MG062737	NA
Coniochaeta fibrosae	CX04D1	MW077645	NA	NA	NA
Coniochaeta mongoliae	CS-09	KP941078	NA	NA	NA
Coniochaeta iranica	806	KP941076	NA	NA	NA
Coniochaeta euphorbiae	1001	KY064029	NA	NA	NA
Coniochaeta cephalothecoides	L821	MW447035	NA	KY064030	NA
Coniochaeta luteorubra	FeC127	MZ241160	NA	NA	NA
Coniochaeta luteorubra	UTHSC 01-20	NA	HE610346	HE610328	NA
Coniochaeta lutea	AEASO10801	MZ241150	NA	NA	MZ241193
Coniochaeta endophytica	ARIZ AEAFL0922	MZ241147	NA	NA	NA
Coniochaeta endophytica	ARIZ AEA 9094	NA	NA	NG_075158	NA
Coniochaeta vineae	KUMCC 17-0322	NA	MN485898	NA	NA
Coniochaeta taeniospora	MFLU 17-0832	NA	MN509784	NA	NA
Coniochaeta discoidea	SANK12878	NA	AY780134	NA	NA
Coniochaeta elegans	FF0093	NA	NA	NA	MZ267815
Coniochaeta nivea	AK0926	NA	NA	NA	MZ267793
Coniochaeta deborreae	BE19_001008	NA	NA	NA	MW890087
Coniochaeta cymbiformispora	QU1057	NA	NA	NA	MZ267839
Coniochaeta endophytica	AEA 9094	NA	NA	NG_075158	MK693159
Colletotrichum nymphaeae	CBS 515.78	NR_111736	NA	NA	NA
Colletotrichum caricae	NW688b	NR_111736	NA	NA	NA
Colletotrichum fioriniae	CBS 151.35	NR_111458	NA	NG_069002	NA
Colletotrichum circinans	CBS 128517	NR_111747	NA	NA	NA
Colletotrichum gloeosporioides	CBS 221.81	NR_111457	NA	NA	NA
Colletotrichum gloeosporioides	IMI 356878	NA	AJ409291	NA	NA
Colletotrichum acutatum	IMI 356878	NR_160754	NA	NA	NA
Colletotrichum acutatum	CBS 112996	NA	AJ409296	NA	NA
Colletotrichum siamense	CBS 112996	NR_144794	NA	NA	NA
Colletotrichum siamense	LC0034	NA	NA	NA	JQ071904
Colletotrichum truncatum	MFLU 090230	NR_144784	NA	NA	NA
Colletotrichum truncatum	CC01	NA	NA	NA	MW030430
Colletotrichum plurivorum	CBS 125474	NA	MG600985	NA	NA
Colletotrichum jasminigenum	LCA923	NA	HM153770	NA	NA
Colletotrichum serranegrense	COAD 2100	NA	KY407896	NA	NA
Colletotrichum neorubicola	CCR144	NA	MN186400	NA	NA
Colletotrichum spicati	YMF 1.04942	NA	OL981226	NA	NA
Colletotrichum fructicola	LC0033	NA	NA	NA	JQ071903
Colletotrichum theobromicola	GJS08_50	NA	NA	NA	GU994506
Colletotrichum horii	C1180.1	NA	NA	NA	GQ329693
Colletotrichum tropicale	LC0598	NA	NA	NA	JQ071909
Colletotrichum kahawae	IMI 319418	NA	NA	NA	JQ071908
Colletotrichum fragariae	MTCC 10325	NA	NA	NA	JQ071906
Colletotrichum camelliae	LC1364	NA	JN936976	NA	NA
Colletotrichum dacrycarpi	CBS 130241	NA	NA	NG_073638	NA
Colletotrichum neosansevieriae	CBS 139918	NA	NA	NG_070628	NA
Colletotrichum arboricola	CBS 144795	NA	NA	NG_070064	NA
Colletotrichum scovillei	CBS 126529	NA	NA	NG_070041	NA
Colletotrichum walleri	CBS 125472	NA	NA	NG_070040	NA
Colletotrichum melonis	CBS 159.84	NA	NA	NG_070037	NA
Colletotrichum brisbanense	CBS 292.67	NA	NA	NG_070034	NA
Phialemonium obovatum	CBS 279.76	HE610365	HE599334	FR691997	LT634003

* NA, not available.

3. Results

3.1. Macroscopic Characterisation

Macroscopic features confirmed the rapid growth time of Coniochaeta species on SDA GC medium at an optimal temperature of 25 °C for all species (Figure 1). However, none of the three yeasts was able to grow at 4 and 45 °C. Colonies of the three isolates were initially white to beige, both on the surface and on the reverse. After four to five days of incubation, Coniochaeta massiliensis turned light orange to salmon. All colonies were flat and moist. Coniochaeta hoffmannii DSM 2693 and the newly isolated yeast (PMML0158) presented a glabrous aspect, while Coniochaeta mutabilis DSM 10716 was typified by an aerial mycelial growth.

Figure 1.

Culture growth on Sabouraud Dextrose Agar + gentamicin and chloramphenicol after five days of incubation at 25 °C. The colour of both the recto and verso of the colonies was white/beige to salmon. (A) Coniochaeta massiliensis PMML0158. (B) Coniochaeta hoffmannii DSM 2693. (C) Coniochaeta mutabilis DSM 10716.

3.2. Microscopic Characterisation

The microscopic observation of the three strains revealed wide septate hyphae, numerous cylindrical adelophialides (short phialides without septum), discrete phialides with conical tips exhibiting ellipsoidal to cylindrical and rarely curved conidia, and nonseptate with thin and smooth conidial walls (2 to 3 by 6 to 10 μm). Several conidia were observed aggregating on the hyphae’s sides and most often in clusters. Collarettes were only found in both Coniochaeta massiliensis and C. mutabilis. No chlamydospore was observed (Figure 2).

Figure 2.

Morphology of Coniochaeta massiliensis (PMML0158). (A,B) Formation of conidiogenous cells (adelophialides) on hyphae and presence of collarette (arrow). (C–F) Conidia aggregating in clusters. (G) Conidia aggregating along the sides of the hyphae. (H) Phialoconidia assembled at the phialide tip. (I,J) Cylindrical conidia with thin and smooth walls. (K,L) Wide hyphae. Optical microscopy (magnification ×1000). Scale bars: 50 μm. Scanning electron microscopy (15 KeV lens mode 4). Scale bars: J = 10 μm; B,F,H = 30 μm; D = 40 μm; L = 50 μm.

3.3. Antifungal Susceptibility Testing (AFST)

The minimum inhibitory concentration (MIC) values for the three species for all nine antifungal drugs are shown in (Table 3). The MIC endpoints for all strains were determined as the lowest concentrations inhibiting the growth of 90% of the strains and were determined as described in Perdomo et al. (2011), since there are no validated AFST guidelines for this genus. The MICs of AMB, 5-FC, ITC, POS, and VOR were low for the three isolates. The new species of Coniochaeta displayed low echinocandin (AND and CAS) MICs and a high FL MIC, while C. hoffmannii and C. mutabilis demonstrated the opposite for these four antifungal drugs.

Table 3.

Results of in vitro antifungal susceptibility testing.

MIC * (mg/L) Read at 48 h
	AMB	AND	CAS	5-FC	FL	ITC	MIF	POS	VOR **
Coniochaeta massiliensis PMML0158	0.25	0.5	1	2	8	0.25	1	0.25	0.12
Coniochaeta hoffmannii DSM 2693	0.12	4	4	1	4	0.06	>32	0.12	0.12
Coniochaeta mutabilis DSM 10716	0.12	4	8	1	2	0.015	>32	0.03	0.03

* MIC, minimum inhibitory concentration; ** AMB, amphotericin B; AND, anidulafungin; CAS, caspofungin; 5-FC, 5-fluorocytosine; FL, fluconazole; ITC, itraconazole; MIF, micafungin; POS, posaconazole; VOR, voriconazole.

3.4. MALDI-TOF MS Identification

The MALDI-TOF MS identification score (log score < 1.90) was below the limit required for obtaining a good identification. The isolate was identified at the genus level as Coniochaeta sp. identification score values were generated from MALDI-TOF MS spectra of the new isolate and the two other reference strains from the DSMZ collection, Coniochaeta mutabilis DSM 10716 and Coniochaeta hoffmannii DSM 2693, which were collected and have been entered in the MALDI-TOF MS database.

3.5. Physiological Analysis

3.5.1. EDX (Energy-Dispersive X-ray Spectroscopy)

The weights and atomic percentages of chemical elements resulting from the chemical mapping performed on the three species of the Coniochaeta genus displayed three distinct profiles. In the principal component analysis (Figure 3), each Coniochaeta species was very distant from the others, demonstrating highly heterogeneous chemical profiles.

Figure 3.

Principal component analysis (PCA) processed with the XLSTAT software of the energy-dispersive X-ray spectroscopy chemical mapping profile, performed for the novel species Coniochaeta massiliensis (PMML0158) and two reference strains in the genus. The principal components F1 and F2 explained 100% of the chemical mapping profile variance.

3.5.2. Biolog^TM System

Biolog^TM advanced phenotypic technology was very useful for the phenotypic characterisation. The oxidation and assimilation test results were illustrated using heat maps (Figure 4 and Figure 5). The majority of the substrates were not oxidized/assimilated. Each heat map was quite heterogeneous, and both demonstrated similar findings: Coniochaeta mutabilis DSM 10716 appeared more divergent from Coniochaeta massiliensis (PMML0158) than from Coniochaeta hoffmannii DSM 2693. However, Coniochaeta massiliensis (PMML0158) appeared to be closely related to Coniochaeta hoffmannii DSM 2693.

Figure 4.

Heat map computed with the XLSTAT software for carbon-source oxidation by the Biolog^TM system for the novel species Coniochaeta massiliensis (PMML0158) and two reference strains in the genus. Colour-gradient interpretation: the most-oxidized substrates are shown in light orange and the least-oxidized substrates are shown in red.

Figure 5.

Heat map computed with the XLSTAT software for carbon-source assimilation by the Biolog^TM system for the novel species Coniochaeta massiliensis (PMML0158) and two reference strains. Colour-gradient interpretation: the most-assimilated substrates are shown in light orange and the least-assimilated substrates are shown in red.

3.6. DNA Sequencing

The sequences were analysed using the BLASTn tool with the reference data available from the GenBank database of NCBI. The BLASTn of the new isolate showed a percent identity ≤97% for the four gene markers. Notably, the best-match pairwise identity was 96.51% for C. rhopalochaeta CBS 109872 with ITS (NR172554.1), 96.41% for C. deborreae BE19 001008 with TEF-1a (MW890087.1), 97.45% for C. deborreae CBS 147215 with D1/D2 (NR076709.1), and 94.44% for Cosmospora inonoticola 9361 with B-tub2 (KU563621.1).

3.7. Phylogenetic Analyses

We built phylogenetic trees using MEGA 11 software. The multilocus analysis of the first tree (Figure 6) based on the assembled sequences of the ITS, B-tub2, and D1/D2 genetic regions revealed that the new isolate Coniochaeta massiliensis (PMML0158) clustered apart and seemed quite distinct from all other Coniochaeta species. Then, we constructed four other trees (Figure 7) with only one locus each, including supplementary Coniochaeta and Colletotrichum species. Within both ITS and TEF-1a trees, Coniochaeta massiliensis PMML0158 clustered with other Coniochaeta species. However, the D1/D2 and B-tub2 trees could not clearly position the new species PMML0158 in the Coniochaeta or Colletotrichum genus. However, the TEF-1a tree (Figure 7D) clearly positioned Coniochaeta massiliensis (PMML0158) as a distinct species within the Coniochaeta genus, which was unambiguously separated from the Colletotrichum genus.

Figure 6.

Multilocus phylogenetic tree of the newly isolated species Coniochaeta massiliensis PMML0158 (indicated with red dots) and 11 reference strains (type strains are indicated with blue dots), based on the concatenated ITS, B-tub2, and D1/D2 sequences. Phialemonium obovatum CBS 279.76 was used as an outgroup. The maximum-parsimony tree was generated using the MEGA 11 software, with 1000-replication bootstrap values.

Figure 7.

Four single-locus phylogenetic trees using the ITS (A), D1/D2 (B), B-tub2 (C), and TEF-1α (D) genomic regions. The species included in each tree differ because the sequences for each locus were not available for all strains. The red dots indicate the new species Coniochaeta massiliensis PMML0158 and blue dots indicate type strains. Phialemonium obovatum CBS 279.76 was used as the outgroup. The maximum-parsimony tree was generated using the MEGA 11 software, with 1000-replication bootstrap values.

3.8. Taxonomy

Coniochaeta massiliensis Kabtani J. & Ranque S. sp. nov.

MycoBank: MB843839

(Figure 2A–L).

Etymology: Named in honour of Marseille (France), the city where it was isolated.

Diagnosis: Closely similar to the other two Coniochaeta species examined, displaying the same flat and moist colonies aspect, as well as the absence of the dematiaceous appearance. However, relying on macroscopic features, it differs from C. mutabilis in that it lacks aerial growth. On the other hand, C. massiliensis presented the same microscopic structures as other species, such as the presence of several adelophialides, discrete phialides, and cylindrical or curved conidia. In this respect, C. massiliensis is closer to C. mutabilis, due to the decisive presence of the collarette.

Type: France: Marseille. Human body (abscess of the hand), 15 July 2020. (Holotype IHEM 28559/PMML0158, stored in a metabolically inactive state.) GenBank: OM366153 (ITS), ON000097 (B-tub2), OM640093 (TEF-1a), OM366268 (D1/D2).

Description: the macroscopic features were characterised by a rapid growth time on SDA GC medium at an optimal temperature of 25 °C. However, Coniochaeta massiliensis was not able to grow at 4 and 45 °C. Colonies were first white to beige, both on the surface and on the reverse after four to five days of incubation, then turned light orange to salmon. Colonies were flat and moist, with a glabrous aspect. There was no aerial mycelial growth. The microscopic features were characterised by the presence of wide septate hyphae, numerous cylindrical adelophialides (short phialides without septum), discrete phialides with conical tips, exhibiting ellipsoidal to cylindrical and rarely curved conidia, nonseptate with thin and smooth conidial walls (2 to 3 by 6 to 10 μm). Several conidia were observed aggregating on the side of the hyphae and most often in clusters. Collarettes were present, but chlamydospores formation was not observed.

The Biolog^TM carbon-source assimilation profile showed that C. massiliensis PMML0158 can assimilate different carbon substrates, such as 2-keto-D-gluconic acid, D-gluconic acid, D-ribose, D-xylose, D-glucosamine, D-cellobiose, D-melibiose, Palatinose, Turanose, L-sorbose, and β-methyl-D-glucoside. Based on this phenotypic analysis, C. massiliensis PMMFL0158 appears similar to C. hoffmannii DSM 2693.

Host: Human

Additional specimen examined: C. Hofmann: Reference: Country of origin unknown. Treated pine stake, before 8 July 1983. (DSM 2693-ATCC 34158–SP33-4.) GenBank: OM366155 (ITS), ON000099 (B-tub2), OM640095 (TEF-1a), OM366270 (D1/D2).

Additional specimen examined: C. mutabilis: Reference: Sweden. Origin of isolation unknown, before 14 June 1996. (DSM 10716-EMPA 573, S24 E.) GenBank: OM366154 (ITS), ON000098 (B-tub2), OM640094 (TEF-1a), OM366269 (D1/D2).

4. Discussion

Coniochaeta mutabilis and Coniochaeta hoffmannii are the most familiar human pathogens of the Coniochaeta genus and the most widespread and commonly encountered in human samples and severe infections. The MALDI-TOF MS identifications for these two species were relevant, with log scores >2.0. However, this tool was not able to perform a species identification for the new isolate, which led to a molecular analysis targeting four relevant genes: the internal transcribed spacer (ITS1/ITS2) in the RNA ribosomal small subunit (SSU), a fragment of the translation elongation factor 1-alpha gene (TEF-1-α), a fragment of the β-tubulin gene (B-tub2), and the D1/D2 domains of the ribosomal DNA large subunit (LSU).

The multilocus phylogenetic tree (Figure 6) constructed with the concatenated sequences of ITS, B-tub2, and D1D2 showed that the type strains C. mutabilis CBS 157.44 and C. hoffmannii CBS 245.38 clustered within distinct clades and that both were distant from Coniochaeta massiliensis (PMML0158). Indeed, this newly isolated yeast was divergent from all other Coniochaeta species present in the tree. However, in the single-locus trees for ITS and B-tub2, Coniochaeta massiliensis (PMML0158) seemed closer to Coniochaeta species than in other single-locus trees for D1/D2 and TEF-1a, where it appeared much more distant from Coniochaeta species than the genus Colletotrichum.

Based on phylogeny, the new isolate seems divergent from the group’s other known taxa of Coniochaeta. de Hoog et al. (2000) described C. lignaria as being genetically closely related to C. hoffmannii. However, in our phylogenetic tree, these yeasts clustered into two different clades, indicating a large distance between the two species. These findings are in line with those of both Perdomo et al. (2011) and Weber and Begerow (2002), who reported significant differences between these species.

Antifungal susceptibility testing showed relatively low MICs for AMB, 5-FC, ITC, POS, and VOR in all strains. These results are in line with those of Perdomo et al. (2011) but contrast with those of other authors [9,13,20] who reported relatively high MICs for AMB and ITC against C. hoffmannii and C. mutabilis.

We macroscopically observed a fast-growing phenotype in Coniochaeta species. This finding contrasts with those of Ahmad et al. (1985), who reported slow colony growth. All species displayed the same flat and moist colonies. Only C. mutabilis additionally displayed low aerial growth, as reported by Drees et al. (2007). The primary colony colour remained unchanged (white/beige to orange/salmon). None of the colonies turned brown/dark in culture even after one month of incubation. This aspect has been well described in C. hoffmanii, a species that lacks the dematiaceous aspect, whereas C. mutabilis is classified within dematiaceous fungi, which are particularly typified by the presence of melanin in hyphae and conidia cell walls, which is responsible for dark pigment emission. Occasionally, certain C. mutabilis species lack the melanin property, as mentioned in Khan et al. (2013), Dress et al. (2007), and Perdomo et al. (2011). This was noted for the C. mutabilis DSM 10716 strain. Furthermore, in this study, the three species lacked the dematiaceous aspect.

The most remarkable morphological characteristics of the Coniochaeta species that have been described were the presence of several adelophialides, discrete phialides, and cylindrical or curved conidia, in addition to the presence or absence of collarettes and chlamydospores, depending on the species [9,14,18,29]. Most of these specific characteristics were observed in the newly described species (PMML0158). Based on this microscopic analysis, we infer that Coniochaeta massiliensis is closer to C. mutabilis, due to the decisive presence of a collarette.

Morphological characterisation helped for species differentiation, and physiological analysis was more convincing in distinguishing the three species, with the aim of describing the new one as thoroughly as possible. EDX (energy-dispersive X-ray spectroscopy) and Biolog^TM phenotypic technology revealed divergent chemical mapping and carbon-source oxidation/assimilation profiles between the new isolate and the two main species of Coniochaeta genus. Moreover, the Biolog^TM system findings were more relevant, as they revealed that the physiological profile of Coniochaeta massiliensis was closer to C. hoffmannii DSM 2693 than to C. mutabilis DSM 10716.

In conclusion, the clinical yeast isolate PMML0158 is herein described as Coniochaeta massiliensis, a new species that can be easily discriminated from the other species in the Coniochaeta genus owing to distinct genomic sequences and chemical and physiological profiles.

Abbreviations

5-FC	5-fluorocytosine
AMB	Amphotericin B
AND	Anidulafungin
CAS	Caspofungin
DNA	Deoxyribonucleic acid
EDX	Energy-dispersive X-ray spectroscopy
FL	Fluconazole
GC	Gentamycin and chloramphenicol
IHU Méditerranée Infection	Institut Hospitalo-Universitaire Méditerranée Infection
ITC	Itraconazole
ITS	Internal transcribed spacers of the rRNA
SDA	Sabouraud Dextrose Agar
LSU	Large subunit of rRNA
MALDI-TOF MS	Matrix-assisted laser desorption/ionization–time of flight mass spectrometry
MICs	Minimum inhibitory concentrations
MIF	Micafungin
NA	Not available
POS	Posaconazole
rRNA	Ribosomal ribonucleic acid
SSU	Small subunit of rRNA
TEF-1α	Partial translation elongation factor 1-alpha gene
B-tub2	Partial β-tubulin 2 gene
VOR	Voriconazole

Author Contributions

Conceptualisation, J.K. and S.R.; methodology, S.R., J.K., and M.M.; formal analysis, J.K., M.M., and S.R.; writing—original draft preparation, J.K.; writing—review and editing, S.R. and M.M. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The Coniochaeta massiliensis holotype is available in the IHU MI (no. PMML0158) and IHEM (no. 28559) strain collections. The nucleotide sequences are available in GenBank (accession nos. OM366153, ON000097, OM640093, and OM366268). The datasets analysed in the current study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors have no conflicts of interest to declare regarding this study.

Funding Statement

This research was funded by the Institut Hospitalo-Universitaire (IHU) Méditerranée Infection and by the French government under the “Investissements d’avenir” (Investments for the Future) programme managed by the Agence Nationale de la Recherche (ANR, fr: National Agency for Research), (reference: Méditerranée Infection 10-IAHU-03) and the Région Provence-Alpes-Côte d’Azur, European ERDF funding (European Regional Development Fund) and PRIMMI (Plateformes de Recherche et d’Innovation Mutualisées Méditerranée Infection).