REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Alkaline phosphatase conjugated goat anti-mouse IgG (Fc specific)	Sigma	A1418
Chemicals, peptides, and recombinant proteins
n-octyl-β-d-glucoside	Generon	O311S
A8-35 amphipol	Anatrace	A835
RABV-G wt protein C-tagged	This paper	Based on Addgene #74288
RABV-G H270P mutant protein	This paper	Based on Addgene #74288
1112-1 IgG and Fab	This paper	N/A
RVC20 IgG and Fab	This paper	N/A
17C7 IgG and Fab	This paper	N/A
RVC58 Fab	This paper	N/A
Mouse polyclonal serum from mice immunized with Rabipur rabies vaccine	This paper	N/A
Critical commercial assays
Pierce Mouse IgG1 Fab and F(ab')2 Preparation kit	ThermoFisher Scientific	44980
ExpiFectamine™ 293 Transfection Kit	ThermoFisher Scientific	A14524
Alexa Fluor 647 conjugation kit	ThermoFisher Scientific	A20186
EnduRen substrate	Promega	E6481
Horseradish-peroxidase-conjugated Streptactin	Iba Life Sciences	2-1502-001
Deposited data
Structure of RABV-G in complex with 17C7 and 1112-1 Fabs	PDB ID: 8A1E	https://www.wwpdb.org/
Map of RABV-G in complex with 17C7 and 1112-1 Fabs	EMDB ID: EMD-15073	https://www.emdataresource.org/
Experimental models: Cell lines
Expi293F cells	ThermoFisher Scientific	A14527
GripTite™ 293 MSR	ThermoFisher Scientific	R79507
1112-1 hybridoma	Wistar Institute, USA	N/A
RABV-G H270P-mutant protein stable cell line	This paper based on Elegheert et al. (2018)	N/A
Oligonucleotides
Primers for RABV-G sequence amplification from Addgene plasmid #74288: F: TAGTAGGCGGCCGCCATG GTCCCACAGGCTCTCC R: TAGTAGTCTAGATTTACGCTTC CGGTTCGAGCCGTGTCTCGCCCCC	This paper	N/A
Recombinant DNA
pVIP-ENTR	Balazs et al., 2013	N/A
pOPINVH	Nettleship et al., 2008	Addgene #26041
pOPINVL	Nettleship et al., 2008	Addgene #26040
pHR-CMV-TetO2-3C-Twin-Strep-IRES-Turquoise2	Elegheert et al., 2018	Addgene #113886
Plasmids for heavy and light chains of 1112-1 Fab	Synthesized	N/A
Plasmids for heavy and light chains of RVC20 Fab	Synthesized based on patent	WO2016078761
Plasmids for heavy and light chains of RVC20 IgG	Synthesized based on patent	WO2016078761
Plasmids for heavy and light chains of 17C7 Fab	Synthesized based on patent	WO2006084006
Plasmids for heavy and light chains of 17C7 IgG	Synthesized based on patent	WO2006084006
Plasmids for heavy and light chains of RVC58 Fab	Synthesized based on patent	WO2016078761
pDSP1-7	Synthesized based on Kondo et al. (2010)	N/A
pDSP8-11	Synthesized based on Kondo et al. (2010)	N/A
Plasmid for RABV-G wt protein C-tagged	Modified with C-tag, based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G wt protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G-GFP wt protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G-GFP H20L mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G H20A mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G-GFP H21L mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G-GFP H21A mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G-GFP H86L mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G H86A mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G-GFP H113L mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G-GFP H113A mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G H150A mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G-GFP H150L mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G H173L mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G-GFP H173A mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G H261L mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G H261A mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G-GFP H261L mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G H303L mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G-GFP H303A mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G H328A mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G H397A mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G-GFP H397L mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G H419A mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G H419L mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G H424L mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G-GFP H424A mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G I268P mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G-GFP E269P mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G H270P mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G-GFP H270P mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G L271P mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G-GFP L271P mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G L272P mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Plasmid for RABV-G H384P mutant protein	Synthesized based on sequence from Kim et al. (2016)	Based on Addgene #74288
Software and algorithms
ImageJ	(Schneider et al., 2012)	https://imagej.nih.gov/ij/
cryoSPARC	Punjani et al. (2017)	https://cryosparc.com/
COOT v.0.8.9.2	Emsley and Cowtan (2004)	https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/
Phenix v.1.19.2	Adams et al. (2002)	https://phenix-online.org/
MolProbity v.4.5.1	Chen et al. (2010)	http://molprobity.biochem.duke.edu/
FlowJo v10 software	BD Biosciences	https://www.flowjo.com/
Biacore S200 v2 Evaluation software	Cytiva	N/A
Prism 9.0	GraphPad Software	https://www.graphpad.com/
PyMOL	Schrodinger	pymol.org
UCSF Chimera/Chimera X	Pettersen et al., 2004; Pettersen et al., 2021	https://www.cgl.ucsf.edu/chimera/; https://www.rbvi.ucsf.edu/chimerax/
BioRender	BioRender	https://biorender.com/
Other
96-well white tissue culture plates	PerkinElmer	6005680
μ-Plate black 96-well plates	Ibidi	89626
CM5 chip	Cytiva	29104988
Biacore S200 instrument	Cytiva	N/A
Strep-Tactin®XT 4Flow® high capacity cartridge	Iba Life Sciences	2-5027-001