KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit polyclonal anti-HA tag antibody - ChIP Grade | Abcam | Cat# ab9110; (RRID: AB_307019) |
| Mouse anti-Bruchpilot Monoclonal antibody | DSHB | Cat# nc82; (RRID: AB_2314866) |
| Alexa Fluor 488 goat anti-rabbit Polyclonal antibody | Abcam | Cat# ab150077; (RRID: AB_2630356) |
| Alexa Fluor 647 goat anti-mouse Polyclonal antibody | Abcam | Cat# ab150115; (RRID: AB_2687948) |
| Chemicals, Peptides, and Recombinant Proteins | ||
| All-trans retinal | Sigma-Aldrich | Cat# R2500; CAS: 116-31-4 |
| 3-octanol | Sigma-Aldrich | Cat# W358126; CAS: 589-98-0 |
| MCH (4-Methylcyclohexanol) | Sigma-Aldrich | Cat# 153095; CAS: 589-91-3 |
| IPA (Isopentyl acetate) | Sigma-Aldrich | Cat# 306967; CAS: 123-92-2 |
| Mineral oil | Sigma-Aldrich | Cat# 330779; CAS: 8042-47-5 |
| Triton-X-100 | Sigma-Aldrich | Cat# HFH10 |
| Dopamine Hydrochloride | Alfa Aesar | Cat# A11136; CAS: 62-31-7 |
| Acetylcholine | Sigma-Aldrich | Cat# A6625; CAS: 60-31-1 |
| TTX (Tetrodotoxin citrate) | Alomone Labs | Cat# T-550; CAS: 18660-81-6 |
| Experimental Models: Organisms/Strains | ||
| D. melanogaster: w1118 | BDSC | Cat# 5905; (RRID:BDSC_5905) |
| D. melanogaster: MB247-GAL4 | BDSC | Cat# 50742; (RRID:BDSC_50742) |
| D. melanogaster: c305a-GAL4 | BDSC | Cat# 30829; (RRID:BDSC_30829) |
| D. melanogaster: OK107-GAL4 | BDSC | Cat# 854; (RRID:BDSC_854) |
| D. melanogaster: MB247-lexA-lexAop-GCaMP6f | A gift from Dr. Andrew Lin | N/A |
| D. melanogaster: UAS-mAChR-B RNAi 1 | BDSC | Cat# 67775; (RRID:BDSC_67775) |
| D. melanogaster: UAS-mAChR-B RNAi 2 | VDRC | Cat# 107137; (RRID:FlyBase_FBst0472091) |
| D. melanogaster: UAS-Dcr-2 | BDSC | Cat# 24651; (RRID:BDSC_24651) |
| D. melanogaster: tub-GAL80ts | BDSC | Cat# 7108; (RRID:BDSC_7108) |
| D. melanogaster: TI{2A-GAL4}mAChR-B[2A-GAL4] | BDSC | Cat# 84650; (RRID:BDSC_84650) |
| D. melanogaster: SPARC2-I-CsChrimson::tdTomato | BDSC | Cat# 84144; (RRID:BDSC_84144) |
| D. melanogaster: MiMIC-mAChR-B-GAL4 | Generated in-house, as previously described40 | N/A |
| D. melanogaster: elav-GAL4 | BDSC | Cat# 458; (RRID:BDSC_458) |
| D. melanogaster: nSyb-IVS-PhiC31 | BDSC | Cat# 84151; (RRID:BDSC_84151) |
| D. melanogaster: GMR71G10-GAL4 | BDSC | Cat# 39604; (RRID:BDSC_39604) |
| D. melanogaster: GMR28H05-GAL4 | BDSC | Cat# 49472; (RRID:BDSC_49472) |
| D. melanogaster: UAS-TNT | BDSC | Cat#28838; (RRID:BDSC_28838) |
| D. melanogaster: UAS-GACh3.0 | BDSC | Cat# 86549; (RRID:BDSC_86549) |
| D. melanogaster: UAS-cAMPr | A gift from Dr. Justin Blau | N/A |
| D. melanogaster: UAS-mCD8-GFP | BDSC | Cat# 32186; (RRID:BDSC_32186) |
| D. melanogaster: UAS-GCaMP6f (attP40) | BDSC | Cat#42747; (RRID:BDSC_42747) |
| D. melanogaster: UAS-GCaMP6f (VK00005) | BDSC | Cat#52869; (RRID:BDSC_52869) |
| D. melanogaster: UAS-mAChR-B | This Paper | N/A |
| D. melanogaster: UAS-mAChR-B-HA | This paper | N/A |
| Software and Algorithms | ||
| MATLAB | MathWorks | https://www.mathworks.com/products/matlab.html; RRID:SCR_001622 |
| GraphPad Prism | GraphPad Software | https://www.graphpad.com/scientific-software/prism/; RRID:SCR_002798 |
| StepOne Software | Applied Biosystems | http://downloads.thermofisher.com/Instrument_Software/qPCR/Step-1/SOP23_Release%20Notes_4482516.pdf StepOne Software (RRID:SCR_014281) |
| Fiji | 81 | https://fiji.sc/; (RRID:SCR_002285) |
| neuPrint | HHMI’s Janelia Research Campus 62 | https://neuprint.janelia.org/?dataset=hemibrain:v1.2.1&qt=findneurons |
| Python (Spyder) | Spyder Doc Contributors, MIT License, Powered by Sphinx 3.5.4 | https://www.spyder-ide.org/ (RRID:SCR_017585) |
| MScan | Sutter Instrument | https://www.sutter.com/MICROSCOPES/mcs.html |
| LabVIEW | National Instruments | https://www.ni.com/en-il/shop/labview.html; (RRID:SCR_014325) |
| LAS AF | Leica Microsystems | N/A |
| Critical commercial assays | ||
| VECTASHIELD® PLUS Antifade Mounting Medium | Vector laboratories | Cat# H-1900 |
| EZ-RNA II kit | Biological Industries | Cat# 20-410-100 |
| High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor | Thermo Scientific | Cat# AB-4374966 |
| Fast SYBR® Green Master Mix | Applied Biosystems | Cat# AB-4385612 |
| Oligonucleotides | ||
| Primer: β-Tubulin Forward: CCAAGGGTCATTACACAGAGG | FlyPrimerBank, Purchased from HyLabs | https://www.flyrnai.org/flyprimerbank DRSC/TRiP Functional Genomics Resources and DRSC-BTRR (RRID:SCR_021963) |
| Primer: β-Tubulin Reverse: ATCAGCAGGGTTCCCATACC | FlyPrimerBank, Purchased from HyLabs | https://www.flyrnai.org/flyprimerbank DRSC/TRiP Functional Genomics Resources and DRSC-BTRR (RRID:SCR_021963) |
| Primer: mAChR-B Forward: ATGCGGTCGCTTAACAAGTC | FlyPrimerBank, Purchased from HyLabs | https://www.flyrnai.org/flyprimerbank DRSC/TRiP Functional Genomics Resources and DRSC-BTRR (RRID:SCR_021963) |
| Primer: mAChR-B Reverse: GCTCCCTTCTAAGGCTCCAG | FlyPrimerBank, Purchased from HyLabs | https://www.flyrnai.org/flyprimerbank DRSC/TRiP Functional Genomics Resources and DRSC-BTRR (RRID:SCR_021963) |
| Recombinant DNA | ||
| cDNA: GEO08261 | Drosophila Genomics Resource Center | https://dgrc.bio.indiana.edu//stock/1654134 GEO08261 (DGRC Stock# 1654134; (RRID:DGRC_1654134) |
| Plasmid: pBID-UASc | Addgene | http://www.addgene.org/35200/ Cat# 35200 (RRID:Addgene_35200) |