REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Rabbit monoclonal anti-BRD4 long isoform (Dilution 1:50) | Cell Signaling Technology | Cat# 13440; RRID: AB_2687578 |
Rabbit monoclonal anti-Vinculin (Dilution 1:50) | Cell Signaling Technology | Cat# 13901; RRID: AB_2728768 |
Bacterial and virus strains | ||
NEB 5-alpha Competent E.coli (High Efficiency) | New England Biolabs | Cat# C2987H |
Chemicals, peptides, and recombinant proteins | ||
Betaine solution (5 M) | Sigma-Aldrich | Cat# B0300-5VL |
Ampicillin antibiotic, sodium salt 25 g | VWR | Cat# 71003-352 |
Restriction enzyme - BamHI | New England Biolabs | Cat# R0136S |
Restriction enzyme - EcoRI | New England Biolabs | Cat# R0101S |
Restriction enzyme - MluI | New England BioLabs | Cat# R0198S |
NEBuffer™ 3:1 (Provided with restriction enzyme) | New England Biolabs | Cat# B7203S |
Luria Broth Base | Invitrogen | Cat# 12795-084 |
SOC Outgrowth Medium | New England Biolabs | Cat# B9020 |
Molecular Biology Grade Agarose LE | Thomas Scientific | Cat# C9961-57 |
Phusion™ High-Fidelity DNA Polymerase (2 U/μL) | Thermo Scientific™ | Cat# F-530L |
Phusion™ G-C Buffer (Provided with Polymerase) | Thermo Scientific™ | Cat# F-530L |
10 mM dNTP Mix | Invitrogen | Cat# 100004893 |
Cold Fusion Cloning Kit with Competent Cells | System Biosciences | Cat# MC010A-1 |
QIAquick Gel Extraction Kit | QIAGEN | Cat# 28704 |
QIAprep Spin Miniprep Kit | QIAGEN | Cat# 27106 |
CompactPrep Plasmid Maxi Kit | QIAGEN | Cat# 12863 |
Blasticidin antibiotic, S HCl (10 mg/mL), liquid | Gibco, Fisher Scientific | Cat# A1113903 |
Critical commercial assays | ||
ProteinSimple Wes 66–440 kDa separation module | ProteinSimple (Bio-Techne) | Cat# SM-W008 |
Deposited data | ||
NCBI Reference Sequence for assembly NM_058243.3 | NCBI/NIH | https://www.ncbi.nlm.nih.gov/nuccore/NM_058243.3 |
Oligonucleotides | ||
Cold fusion cloning BRD4-L forward primer: 5′ GGTGTCGTGACG CGGCTATGTCTGCGGAGAGCGG 3′ |
This paper | CF-BRD4-L_pLV-F |
Cold fusion cloning BRD4-L reverse primer: 5′ CCATGGTGGCGGATCCC TAGGTGCGCTCAGAAAAGA 3′ |
This paper | CF-BRD4-L_pLV-R |
Recombinant DNA | ||
LentiV_Blast mammalian stable overexpression plasmid | Addgene; (Tarumoto et al., 2020) | Cat# 111887; RRID: Addgene_111887 |
pcDNA5-Flag-BRD4-WT transient expression plasmid | Addgene, a gift from Dr. Kornelia Polyak (Shu et al., 2016) | Cat# 90331; RRID: Addgene_90331 |
LentiV_Puro mammalian stable overexpression plasmid | Addgene, a gift from Christopher Vakoc (Tarumoto et al., 2020) | Cat# 111886; RRID: Addgene_111886 |
pLentiTRE/rtTA inducible stable overexpression plasmid | A gift from Trudy Oliver (Bieniasz et al., 2015) | N/A |
LentiV_Blast-BRD4-L stable overexpression plasmid | This paper | LentiV_Blast-BRD4-L |
LentiV_Puro-BRD4-L stable overexpression plasmid | This paper | LentiV_Puro-BRD4-L |
pLentiTRE/rtTA-BRD4-L inducible overexpression plasmid | This paper | pLentiTRE/rtTA-BRD4-L |
Software and algorithms | ||
GenBank | NCBI/NIH | https://www.ncbi.nlm.nih.gov/genbank/ RRID: SCR_002760 |
Oligo Calculator, version 3.27 | Northwestern University (Kibbe, 2007) | http://biotools.nubic.northwestern.edu/OligoCalc.html |
Image Lab, version 6.0.1 | Bio-Rad | RRID: SCR_014210 |
Compass software for SW, version 4.0.0 | ProteinSimple (Bio-Techne) | https://www.proteinsimple.com/compass/downloads/ |
Other | ||
UltraPure™ DNase/RNase Free distilled water | Invitrogen™ | Cat# 10977015 |
GeneRuler 100 bp Plus DNA Ladder | Thermo Scientific™ | Cat# SM0323 |
GeneRuler 1 kb Plus DNA Ladder | Thermo Scientific™ | Cat# SM1334 |
DS-11+Spectrophotometer | DeNovix | N/A |
Master Cycler Pro thermocycler | Eppendorf | N/A |
Mini-sub Cell GT System gel running system | Bio-Rad | N/A |
Chemidoc MP Imaging System | Bio-Rad | N/A |
New Brunswick Innova 40 benchtop shaker | Innova | N/A |
Eppendorf ThermoMixer C | Eppendorf | N/A |
ProteinSimple Wes System | ProteinSimple (Bio-Techne) | N/A |