| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse anti-Arl13b (clone N295B/66) (monoclonal) | UC Davis/NIH NeuroMab Facility | Cat# 75-287; RRID: AB_2341543 |
| Rabbit anti-ARL13B (polyclonal) | Proteintech | Cat# 17711-1-AP; RRID: AB_2060867 |
| Rabbit anti-COUP-TFII (polyclonal) | Provided by M Studer | |
| Rat anti-Ctip2 (monoclonal) | Abcam | Cat# ab18465; RRID: AB_2064130 |
| Guinea pig anti-DLX2 (polyclonal) | Bioacademica | Cat# 74-116 |
| Rabbit anti-EMX1 (polyclonal) | Edoardo Boncinelli | Briata et al. (1996) |
| Rabbit anti-FOXG1 (polyclonal) | Abcam | Cat# ab18259; RRID: AB_732415 |
| Guinea pig anti-GLI2 (polyclonal) | Jonathan Eggenschwilter | Cho et al. (2008) |
| Mouse anti-Polyglutamylation Modification (clone GT335) | AdipoGen | Cat# AG-20B-0020; RRID: AB_2490210 |
| Rabbit anti-GPR161 (polyclonal) | Proteintech | Cat# 13398-1-AP; RRID: AB_2113965 |
| Rabbit anti-GSX2 (polyclonal) | Millipore | Cat# ABN162; RRID: AB_11214376 |
| Rabbit anti-IFT81 (polyclonal) | Proteintech | Cat# 11744-1-AP; RRID:AB_2121966 |
| Rabbit anti-IFT88 (polyclonal) | Proteintech | Cat# 13967-1-AP; RRID:AB_2121979 |
| Rabbit anti-IFT144/WDR19 (polyclonal) | Proteintech | Cat#13647-1-AP; RRID: AB_10598484 |
| Rabbit anti-INPP5E (polyclonal) | Proteintech | Cat# 17797-1-AP; RRID: AB_2167120 |
| Mouse anti-ISL1/2 (monoclonal) | DSHB | Cat# 39.4D5; RRID: AB_2314683 |
| Mouse anti-NKX2.1/TTF1 (monoclonal) (clone 8G7G3/1) | Abcam | Cat# ab3186 |
| Rabbit anti-OLIG2 (polyclonal) | Millipore | Cat# AB9610; RRID: AB_570666 |
| Rabbit anti-PAX6 (polyclonal) | Biolegend | Cat# 901301; RRID: AB_2565003 |
| Rabbit anti-RPGRIP1L (polyclonal) | Proteintech | Cat#55160-1-AP; RRID: AB_10860269 |
| Rabbit anti-SMO (polyclonal) | Proteintech | Cat# 20787-1-AP; RRID: AB_2878740 |
| Rabbit anti-SOX2 (monoclonal) | Abcam | Cat# ab92494; RRID: AB_10585428 |
| Rabbit anti-SST (Somatostatin-14) | Peninsula Laboratories | Cat# T-4102.0400; RRID: AB_518613 |
| Rabbit anti-SUFU (polyclonal) | Proteintech | Cat# 26759-1-AP; RRID: AB_2880625 |
| Rabbit anti-TBR1 (polyclonal) | Abcam | Cat# ab31940; RRID: AB_2200219 |
| Rabbit anti-TBR2 (polyclonal) | Abcam | Cat# ab23345; RRID:AB_778267 |
| Rabbit anti-TCTN1 (polyclonal) | Proteintech | Cat#15004-1-AP; RRID: AB_10644442 |
| Rabbit anti-MSK3/TMEM67 (polyclonal) | Proteintech | Cat# 13975-1-AP; RRID: AB_10638441 |
| Mouse anti-gammaTUB (monoclonal) (clone GTU-88) | Sigma-Aldrich | Cat# T6557; RRID: AB_477584 |
| Rabbit anti-TULP3 (polyclonal) | Proteintech | Cat# 13637-1-AP; RRID: AB_2211547 |
| Mouse anti-multi Ubiquitin IgG1 clone FK2 | MBL International | Cat# D058-3; RRID: AB_592937 |
| Donkey anti-mouse IgG Cy2 (polyclonal) | Jackson ImmunoResearch Labs | Cat# 715-225-151; RRID: AB_2340827 |
| Donkey anti-rabbit IgG Cy3 (polyclonal) | Jackson ImmunoResearch Labs | Cat# 711-165-152; RRID: AB_2307443 |
| Goat anti-rat IgG Cy3 (polyclonal) | Jackson ImmunoResearch Labs | Cat# 112-165-003; RRID: AB_2338240 |
| Goat anti-mouse IgG2b, Alexa Fluor 647 conjugated (polyclonal) | Innovative Research | Cat# A21242; RRID: AB_1500900 |
| Goat anti-rat IgG Alexa Fluor 647 conjugated (polyclonal) | Molecular Probes | Cat# A-21247; RRID: AB_141778 |
| Pig anti-rabbit IgG, biotinylated (polyclonal) | Dako | Cat# E0431 |
| Streptavidin, Alexa Fluor 488 conjugate antibody | Molecular Probes | Cat# S32354; RRID: AB_2315383 |
| Streptavidin, Alexa Fluor® 568 conjugate antibody | Thermo Fisher Scientific | Cat# S-11226; RRID: AB_2315774 |
| DAPI (4′,6-Diamidino-2-Phenylindole, Dihydrochloride) | Thermo Fisher Scientific | Cat# D1306; RRID: AB_2629482 |
| Mouse anti-TRA-1-60 (monoclonal) | Santa Cruz Biotechnology | Cat# sc-21705; RRID: AB_628385 |
| Rabbit anti-NANOG (polyclonal) | Cell Signaling Technology | Cat# 3580; RRID: AB_2150399 |
| Mouse anti-OCT3/4 (monoclonal) | Santa Cruz Biotechnology | Cat# sc-5279; RRID: AB_628051 |
| Goat anti-rabbit IgG Alexa Fluor 488 conjugated (polyclonal) | Molecular Probes | Cat# A-11008; RRID: AB_143165 |
| Goat anti-mouse IgM, Alexa Fluor 555 conjugated (polyclonal)l | Innovative Research | Cat# A21426; RRID: AB_1500929 |
| Goat anti-rabbit IgG, biotinylated (polyclonal) | Agilent | Cat# E0432; RRID: AB_2313609 |
| Mouse anti-β-Actin (clone AC-15) (monoclonal) | Abcam | Cat# ab6276; RRID:AB_2223210 |
| Goat anti-h/m GLI3 (polyclonal) | R&D Systems | Cat# AF3690; RRID: AB_2232499 |
| IRDye 680RD Donkey anti-Goat IgG | LI-COR Biosciences | Cat# 926-68074; RRID: AB_10956736 |
| IRDye 800CW Donkey anti-Mouse IgG | LI-COR Biosciences | Cat# 925-32212; RRID: AB_2716622 |
| Biological samples | ||
| Human embryonic and fetal brain tissue | Human Developmental Biology Resource | www.hdbr.org |
| Chemicals, peptides, and recombinant proteins | ||
| Essential 8™ Medium | Thermo Fisher Scientific | Cat#A1517001 |
| Matrigel Basement Membrane Matrix High Concentration (HC) | Scientific Laboratory Supplies | Cat#354230 |
| Matrigel | Corning | Cat#354248 |
| DMEM/F12 | Thermo Fisher Scientific | Cat#11330032 |
| Fetal Calf Serum (FCS) | Thermo Fisher Scientific | Cat#12103C |
| L-glutamine | Thermo Fisher Scientific | Cat#25030024 |
| Lipofectamine 2000 | Thermo Fisher Scientific | Cat#STEM00001 |
| T7 endonuclease I | New England Biolabs | Cat#M0302 |
| Accutase | Stem Cell Technologies | Cat#0792207920 |
| Rock Inhibitor (Y-27632) | Stem Cell Technologies | Cat#72302 |
| Puromycin | Thermo Fisher Scientific | Cat#J67236.8EQ |
| GoTaq G2 DNA polymerase | Promega | Cat#M7845 |
| ApoI-HF | New England Biolabs | Cat#R3566L |
| Antibiotic-Antimycotic | Thermo Fisher Scientific | Cat#15240062 |
| Dispase | Thermo Fisher Scientific | Cat#17105041 |
| Collagenase | Thermo Fisher Scientific | Cat#17104019 |
| Iscove’s Modified Dulbecco’s Medium (IMDM) | Thermo Fisher Scientific | Cat#21980032 |
| Ham’s F-12 Nutrient Mix | Thermo Fisher Scientific | Cat#21765029 |
| BSA | Europa Bioproducts | Cat#EQBAC62 |
| Chemically Defined Lipid Concentrate | Thermo Fisher Scientific | Cat#11905031 |
| Monothioglycerol | Sigma | Cat#M6145 |
| Human Insulin | Sigma | Cat#11376497001 |
| Transferrin | Sigma | Cat#10652202001 |
| N-acetyl cysteine | Sigma | Cat#A8199 |
| Activin Inhibitor (SB431542) | R & D Systems | Cat#1614 |
| LDN-193189 | StraTech | Cat#S2618-SEL |
| Advanced DMEM/F12 | Thermo Fisher Scientific | Cat#12634028 |
| GlutaMAX™ Supplement | Thermo Fisher Scientific | Cat#35050038 |
| N2 Supplement | Thermo Fisher Scientific | Cat#17502001 |
| B27 Supplement | Thermo Fisher Scientific | Cat#17504001 |
| Murine FGF-basic | PeproTech | Cat#450-33 |
| Neurobasal™ Medium | Thermo Fisher Scientific | Cat#21103049 |
| B27 Supplement Minus Vitamin A | Thermo Fisher Scientific | Cat#12587010 |
| MEM Non-Essential Amino Acids Solution | Thermo Fisher Scientific | Cat#11140050 |
| Purmorphamine CAS 483367-10-8-Calbiochem | Merk | Cat#540220 |
| Cyclopamine, V.californicum | Millipore | Cat#239803 |
| Superscript™ IV VILO™ Master Mix with ezDNase | Thermo Fisher Scientific | Cat#11766050 |
| NuPAGE Tris-Acetate Mini gel (3-8%) | Life Technologies | Cat#EA0375 |
| Critical commercial assays | ||
| Amaxa P3 Primary Cell 4D-Nucleofector™ X Kit | Lonza | Cat#V4XP-3012 |
| RNeasy Plus Micro Kit | Qiagen | Cat#74034 |
| QuantiFast SYBR Green PCR Kit | Qiagen | Cat#204054 |
| Deposited data | ||
| RNAseq INPP5e organoids | This paper | EBI: E-MTAB-11437 |
| Experimental models: Cell lines | ||
| iPSC control line hPSC1 | Mandy Johnstone | (Johnstone et al., 2019; Selvaraj et al., 2018; Vasistha et al., 2019) |
| iPSC control lines hPSC2 (male) (CS02iCTR-n1) | Cedars-Sinai | N/A |
| iPSC control lines hPSC3 (male) (CS25iCTR-18n2) | Cedars-Sinai | N/A |
| iPSC INPP5ED477ND477N hPSM1 clone (1C2) | This paper | N/A |
| iPSC INPP5ED477ND477N hPSM2 clone (2A6) | This paper | N/A |
| HEK 293 | ATCC | https://www.atcc.org/products/crl-1573 |
| Oligonucleotides | ||
| gRNA 5′-CTGTGCGCCCGCCACTCAGG-3′ |
This paper | N/A |
| ssODN D447N for gene editing 5′GCCGCAGCGGACGTCACCACCCGCTTCGATGAGGTGTTC TGGTTTGGAAATTTCAACTTCAGGCTGAGTGGCGGGCGCAC AGTCGTGGACGCCCTCCTGTGCCAGGGCCTGGTGGTGGAC GTGCCGGCGCTGCTGCAGCACGACCAGCTCATCCGGGAGA TGCGGAAAGGTG3′ |
This paper | N/A |
| Inp D477N Fw 5′-GCGGTTCTTTAGCACGGTTA-3′ |
This paper | N/A |
| Inp D477N Rev 5′-CTCCTCATCTCCCTCCATG-3′ |
This paper | N/A |
| Oligonucleotides for CrisprCas9 off targets, see Table S1 | This paper | N/A |
| Primers for ISH and qPCR, see Table S1 | This paper | N/A |
| Recombinant DNA | ||
| pSpCas9(BB)-2A-Puro (PX459) | (Ran et al., 2013) | RRID:Addgene_48139 |
| pEGFP-Puro | (Abbate et al., 2001) | RRID:Addgene_45561 |
| pBS hSHH (CT#401) | Cliff Tabin | RRID:Addgene_13996 |
| pSpCas9(BB)-gRNA(INPP5E-D477N)-2A-Puro (PX459) | This paper | N/A |
| Software and algorithms | ||
| Fiji (ImageJ) | https://imagej.net/Fiji | N/A |
| Image Studio Lite | http://www.licor.com/bio/products/software/impage_studio_lite | RRID:SCR_013715 |
| GraphPad Prism 9 | http://graphpad.com | RRID:SCR_002798 |
| Adobe Photoshop (12.1) | https://www.adobe.com/products/photoshop.html | RRID:SCR_014199 |
| CRISPR design tool | http://crispr.mit.edu | Broad Institute |
| Opticon Monitor software v1 | Bio-Rad Laboratories, Inc. | N/A |
| Huygens Essential Software | https://svi.nl/HuygensSoftware | RRID:SCR_014237 |
| STAR alignment | (Dobin et al., 2013) | https://www.ncbi.nlm.nih.gov/pubmed/23104886 |
| Samtools | (Li et al., 2009) | http://samtools.sourceforge.net/ |
| FeatureCounts | (Liao et al., 2014) | https://www.ncbi.nlm.nih.gov/pubmed/24227677 |
| R Studio version 1.2.5033 | Tim Lebedkov | https://www.npackd.org/p/rstudio/1.2.5033 |
| Deseq2 version 1.30.1 | (Love et al., 2014) | https://www.ncbi.nlm.nih.gov/pubmed/25516281 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.