| Antibodies |
|
| F5111 Antibody |
This manuscript; see Table S1
|
N/A |
| F5111.2 Antibody (N297A) |
This manuscript; see Table S1
|
N/A |
| Trastuzumab Antibody |
This manuscript |
N/A |
| Anti-human IgG Fc APC [HP6017] |
BioLegend |
Cat# 409306; RRID: AB_11149491 |
| Anti-mouse/human phospho-STAT5 AlexaFluor 647 [pY694] |
BD Biosciences |
Cat# 562076; RRID: AB_11154412 |
| Anti-human CD3 APC-eFluor780 [UCHT1] |
ThermoFisher Scientific |
Cat# 47-0038-42; RRID: AB_1272042 |
| Anti-human CD4 PerCP-Cy5.5 [SK3] |
BD Biosciences |
Cat# 341654; RRID: AB_400452 |
| Anti-human CD8 BV605 [SK1] |
BioLegend |
Cat# 344742; RRID: AB_2566513 |
| Anti-human IL-2Rα BV421 [M-A251] |
BD Biosciences |
Cat# 562442; RRID: AB_11154578 |
| Anti-human FOXP3 PE [236A/E7] |
BD Biosciences |
Cat# 560852; RRID: AB_10563418 |
| Anti-human CD127 AlexaFluor 488 [eBioRDR5] |
ThermoFisher Scientific |
Cat# 53-1278-42; RRID: AB_2744750 |
| Anti-mouse CD3 BV510 [145-2C11] |
BioLegend |
Cat# 100353; RRID: AB_2565879 |
| Anti-mouse CD4 APC-eF780 [RM4-5] |
ThermoFisher Scientific |
Cat# 47-0042-82; RRID: AB_1272183 |
| Anti-mouse CD8a AlexaFluor 488 [53-6.7] |
BD Biosciences |
Cat# 557668; RRID: AB_396780 |
| Anti-mouse IL-2Rα PE [PC61.5] |
ThermoFisher Scientific |
Cat# 12-0251-83; RRID: AB_465608 |
| Anti-mouse FOXP3 eFluor450 [FJK-16s] |
ThermoFisher Scientific |
Cat# 48-5773-82; RRID: AB_1518812 |
| Anti-human CD4 PerCP-Cy5.5 [SK3] |
BD Biosciences |
Cat# 566316; RRID: AB_2739678 |
| Anti-mouse CD4 eFluor450 [RM4-5] |
ThermoFisher Scientific |
Cat# 48-0042-82; RRID: AB_1272194 |
| Anti-mouse CD49b PE-Cy7 [DX5] |
BioLegend |
Cat# 108922; RRID: AB_2561460 |
| Anti-mouse CD16/32 [2.4G2] |
BD Biosciences |
Cat# 553142; RRID: AB_394657 |
| Anti-mouse FOXP3 APC [FJK-16s] |
ThermoFisher Scientific |
Cat# 17-5773-82; RRID: AB_469457 |
| Anti-mouse CD8a BV570 [53-6.7] |
BioLegend |
Cat# 100739; RRID: AB_10897645 |
| Anti-mouse Ki-67 AlexaFluor 488 [16A8] |
BioLegend |
Cat# 652417; RRID: AB_2564236 |
| Anti-mouse CD44 PerCP-Cy5.5 [IM7] |
ThermoFisher Scientific |
Cat# 45-0441-82; RRID: AB_925746 |
| Anti-mouse/human Helios PE/Dazzle 594 [22F6] |
BioLegend |
Cat# 137231; RRID: AB_2565796 |
| Anti-mouse CD45 APC-Cy7 [QA17A26] |
BioLegend |
Cat# 157617; RRID: AB_2890720 |
| Anti-mouse TER-119 APC-Cy7 [TER-119] |
BioLegend |
Cat# 116223; RRID: AB_2137788 |
| Anti-human CD3 BV605[OKT3] |
BioLegend |
Cat# 317321; RRID: AB_11126166 |
| Anti-human CD56 PE [TULY56] |
ThermoFisher Scientific |
Cat# 12-0566-41; RRID: AB_2572562 |
| Anti-human CD4 PE-eFluor610 [RPA-T4] |
ThermoFisher Scientific |
Cat# 61-0049-42; RRID: AB_2574522 |
| Anti-human CD8 BV711 [SK1] |
BioLegend |
Cat# 344733; RRID: AB_2565242 |
| Anti-human IL-2Rα PE-Cy7 [M-A251] |
BD Biosciences |
Cat# 557741; RRID: AB_396847 |
| Anti-human FOXP3 AlexaFluor 647 [259D] |
BioLegend |
Cat# 320214; RRID: AB_492984 |
| Anti-human Ki-67 FITC [20Raj1] |
ThermoFisher Scientific |
Cat# 11-5699-42; RRID: AB_10687464 |
| Anti-mouse CD45 PerCP-Cy5.5 [30-F11] |
BioLegend |
Cat# 103132; RRID: AB_893340 |
| Anti-mouse CD3 BV605 [17A2] |
BioLegend |
Cat# 100237; RRID: AB_2562039 |
| Anti-mouse CD4 APC [GK1.5] |
BioLegend |
Cat# 100411; RRID: AB_312696 |
| Anti-mouse CD8a BV786 [53-6.7] |
BD Biosciences |
Cat# 563332; RRID: AB_2721167 |
| Anti-mouse IL-2Rα BV421 [7D4] |
BD Biosciences |
Cat# 564571; RRID: AB_2738849 |
| Anti-mouse FOXP3 FITC [FJK-16s] |
ThermoFisher Scientific |
Cat# 11-5773-82; RRID: AB_465243 |
| Anti-mouse NK-1.1 PerCP-Cy5.5 [PK136] |
BioLegend |
Cat# 108727; RRID: AB_2132706 |
| Anti-mouse CD45.1 APC-Cy7 [A20] |
BioLegend |
Cat# 110716; RRID: AB_313505 |
| Anti-mouse CD45.2 PerCP-Cy5.5 [104] |
BioLegend |
Cat# 109828; RRID: AB_893350 |
| Anti-mouse CD62L PE [MEL-14] |
BioLegend |
Cat# 104408; RRID: AB_313095 |
| Anti-mouse CD44 AlexaFluor 700 [IM7] |
BioLegend |
Cat# 103026; RRID: AB_493713 |
| Anti-mouse CD16/32 [2.4G2] |
Bio X Cell |
Cat# BP0307; RRID: AB_2736987 |
| Rat IgG Isotype Control |
ThermoFisher Scientific |
Cat# 10700; RRID: AB_2610661 |
| Anti-mouse CD4 BUV563 [GK1.5] |
BD Biosciences |
Cat# 612923; RRID: AB_2870208 |
| Anti-mouse CD8a BUV615 [53-6.7] |
BD Biosciences |
Cat# 613004; RRID: AB_2870272 |
| Anti-mouse CD11a BUV805 [2D7] |
BD Biosciences |
Cat# 741919; RRID: AB_2871232 |
| Anti-mouse IL-2Rα BV785 [PC61] |
BioLegend |
Cat# 102051; RRID: AB_2564131 |
| Anti-mouse CD27 BV650 [LG.3A10] |
BioLegend |
Cat# 124233; RRID: AB_2687192 |
| Anti-mouse CD44 BV570 [IM7] |
BioLegend |
Cat# 103037; RRID: AB_10900641 |
| Anti-mouse CD69 BUV737 [H1.2F3] |
BD Biosciences |
Cat# 612793; RRID: AB_2870120 |
| Anti-mouse CD122 BUV661 [TM-β1] |
BD Biosciences |
Cat# 741493; RRID: AB_2870951 |
| Anti-mouse KLRG1 BUV395 [2F1] |
BD Biosciences |
Cat# 740279; RRID: AB_2740018 |
| Anti-mouse ICOS APC/Fire 750 [C398.4A] |
BioLegend |
Cat# 313536; RRID: AB_2632923 |
| Anti-mouse PD-1 BV421 [29F.1A12] |
BioLegend |
Cat# 135218; RRID: AB_2561447 |
| Anti-mouse BCL-2 AlexaFluor 647 [BCL/10C4] |
BioLegend |
Cat# 633510; RRID: AB_2274702 |
| Anti-mouse CD3 BV570 [17A2] |
BioLegend |
Cat# 100249; RRID: AB_2734148 |
| Anti-mouse CTLA-4 APC-R700 [UC10-4F10-11] |
BD Biosciences |
Cat# 565778; RRID: AB_2739350 |
| Anti-mouse FOXP3 PE-Cy5.5 [FJK-16s] |
ThermoFisher Scientific |
Cat# 35-5773-82; RRID: AB_11218094 |
| Anti-mouse Ki-67 AlexaFluor 488 [B56] |
BD Biosciences |
Cat# 558616; RRID: AB_647087 |
| Anti-mouse T-bet PE-Cy5 [4B10] |
ThermoFisher Scientific |
Cat# 15-5825-82; RRID: AB_2815071 |
| Anti-mouse CXCR3 BV650 [CXCR3-173] |
BioLegend |
Cat# 126531; RRID: AB_2563160 |
| Anti-mouse NK-1.1 BV711 [PK136] |
BioLegend |
Cat# 108745; RRID: AB_2563286 |
| Anti-mouse NKp46 BV605 [29A1.4] |
BioLegend |
Cat# 137619; RRID: AB_2562452 |
| Anti-mouse PD-1 [RMP1-14] |
Bio X Cell |
Cat# BE0146; RRID: AB_10949053 |
|
| Bacterial and virus strains |
|
| One Shot™ MAX Efficiency™ DH5α-T1R Competent Cells |
ThermoFisher Scientific |
Cat# 12297016 |
|
| Biological samples |
|
| Human PBMCs |
Anne Arundel Medical Blood Donor Center; NHS Blood and Transport |
N/A |
|
| Chemicals, peptides, and recombinant proteins |
|
| Polyethylenimine, Linear, MW 25000, Transfection Grade (PEI 25K™) |
Polysciences |
Cat# 23966 |
| OptiPRO™ SFM |
ThermoFisher Scientific |
Cat# 12309019 |
| FreeStyle™ 293 Expression Medium |
ThermoFisher Scientific |
Cat# 12338018 |
| Pierce™ Protein G Agarose |
ThermoFisher Scientific |
Cat# 20397 |
| F5111 IC LN15 |
This manuscript; see Table S1
|
N/A |
| F5111 IC LN25 |
This manuscript; see Table S1
|
N/A |
| F5111 IC LN35 |
This manuscript; see Table S1
|
N/A |
| F5111 IC LN35 (Y35A) |
This manuscript; see Table S1
|
N/A |
| F5111 IC LN35 (Y52A) |
This manuscript; see Table S1
|
N/A |
| F5111 IC LN35 (Y54A) |
This manuscript; see Table S1
|
N/A |
| F5111 IC LN35 (Y60A) |
This manuscript; see Table S1
|
N/A |
| F5111 IC LN35 (V103A) |
This manuscript; see Table S1
|
N/A |
| F5111 IC LN35 (Y33A) |
This manuscript; see Table S1
|
N/A |
| F5111 IC LN35 (Y94A) |
This manuscript; see Table S1
|
N/A |
| F5111 IC LN35 (S96A) |
This manuscript; see Table S1
|
N/A |
| F5111.2 IC LN35 |
This manuscript; see Table S1
|
N/A |
| Control (FITC-E2) IC LN35 |
This manuscript; see Table S1
|
N/A |
| F5111 IC LN35 (N297A) |
This manuscript; see Table S1
|
N/A |
| F5111 IC LN35 (Y60A, N297A) |
This manuscript; see Table S1
|
N/A |
| F5111 IC LN35 (V103A, N297A) |
This manuscript; see Table S1
|
N/A |
| F5111 IC LN35 (Y33A, N297A) |
This manuscript; see Table S1
|
N/A |
| F5111.2 IC LN35 (N297A) |
This manuscript; see Table S1
|
N/A |
| Control (FITC-E2) IC LN35 (N297A) |
This manuscript; see Table S1
|
N/A |
| Human IL-2 |
This manuscript |
N/A |
| Biotinylated human IL-2 |
This manuscript |
N/A |
| Biotinylated human IL-2Rα |
This manuscript |
N/A |
| Biotinylated human IL-2Rβ |
This manuscript |
N/A |
| Ni-NTA Agarose |
Qiagen |
Cat# 30210 |
| 16% Paraformaldehyde (formaldehyde) aqueous solution |
Electron Microscopy Science |
Cat# 15710 |
| Ficoll® Paque Plus |
MilliporeSigma |
Cat# GE17-1440-02 |
| ACK Lysing Buffer |
Quality Biological |
Cat# 118-156-101 |
| LIVE/DEAD™ Fixable Blue Dead Cell Stain Kit |
ThermoFisher Scientific |
Cat# L34961
|
| eBioscience™ Fixable Viability Dye eFluor™ 780 |
ThermoFisher Scientific |
Cat# 65-0865-18 |
| Violet Proliferation Dye 450 |
BD Biosciences |
Cat# 562158 |
| Zombie NIR™ Fixable Viability Kit |
BioLegend |
Cat# 423105 |
| NHS-Rhodamine (5/6-carboxy-tetramethyl-rhodamine succinimidyl ester), mixed isomer |
ThermoFisher Scientific |
Cat# 46406 |
| CD4 (L3T4) MicroBeads, mouse |
Miltenyi |
Cat# 130-117-043 |
| CellTrace™ Violet Cell Proliferation Kit |
ThermoFisher Scientific |
Cat# C34571
|
| Dynabeads™ Mouse T-Activator CD3/CD28 for T-Cell Expansion and Activation |
ThermoFisher Scientific |
Cat# 11452D |
| Ghost Dye™ Violet 510 |
Tonbo Biosciences |
Cat# 13-0870-T100 |
| Tetramer H2k(b) Tgd057 PE: SVLAFRRL |
NIH Tetramer Core Facility; Wilson et al., 2010
|
N/A |
| Tetramer I-A(b) AS15 PE: AVEIHRPVPGTAPPS |
NIH Tetramer Core Facility; Grover et al., 2012
|
N/A |
| Power SYBR™ Green PCR Master Mix |
ThermoFisher Scientific |
Cat# 4368577 |
| Dextran sulfate sodium salt, colitis grade (36,000–50,000) |
MP Biomedicals |
Cat# 160110; Lot# S5036 |
|
| Critical commercial assays |
|
| BirA biotin-protein ligase standard reaction kit |
Avidity |
Cat# BirA500 |
| Octet® Streptavidin (SA) Biosensor |
Sartorius |
Cat# 18-5019 |
| Transcription Factor Phospho Buffer Set |
BD Biosciences |
Cat# 565575 |
| eBioscience™ Foxp3/Transcription Factor Staining Buffer Set |
ThermoFisher Scientific |
Cat# 00-5523-00 |
| DNeasy Blood & Tissue Kit |
Qiagen |
Cat# 69506 |
|
| Experimental models: Cell lines |
|
| FreeStyle™ 293-F Cells |
ThermoFisher Scientific |
Cat# R79007
|
| YT-1 Human NK Cells |
Yodoi et al., 1985
|
N/A |
| IL-2Rα+ YT-1 Human NK Cells |
Kuziel et al., 1993
|
N/A |
|
| Experimental models: Organisms/strains |
|
| Mouse: NOD/ShiLt |
The Jackson Laboratory |
Strain #:001976; RRID: IMSR_JAX:001976 |
| Mouse: BALB/c Rag2−/− γc−/− H2d (BRG) |
The Jackson Laboratory |
Strain #: 014593 RRID: IMSR_JAX:014593 |
| Mouse: C57BL/6 |
The Jackson Laboratory |
Strain #:000664; RRID: IMSR_JAX:000664 |
| Mouse: C57BL/6 CD45.1 |
The Jackson Laboratory |
Strain #:002014; RRID: IMSR_JAX:002014 |
| Mouse: C57BL/6 FOXP3-IRES-mRFP |
The Jackson Laboratory |
Strain #:008374; RRID: IMSR_JAX:008374 |
| Mouse: C57BL/6 CD45.1; RFP-FOXP3 mice |
This manuscript; CD45.1 mice were bred in house to FoxP3-RFP mice to homozygosity and maintained at Johns Hopkins University Cancer Research Building 1 use facility |
N/A |
| Mouse: C57BL/6 |
Taconic Biosciences |
Model: B6-M |
|
Toxoplasma gondii – ME49 strain |
N/A |
N/A |
| Mouse: CBA/Ca |
The Jackson Laboratory |
Strain #: 000654 RRID: IMSR_JAX:000654 |
| Mouse: BALB/c |
Purchased from Charles River Laboratories and bred at Czech Centre for Phenogenomics |
Strain: 028 |
|
| Oligonucleotides |
|
| qPCR primer: TCCCCTCTGCTGGCGAAAAGT (Toxoplasma gondii forward) |
This manuscript; Lin et al., 2000
|
N/A |
| qPCR primer: AGCGTTCGTGGTCAACTATCGATTG (Toxoplasma gondii reverse) |
This manuscript; Lin et al., 2000
|
N/A |
|
| Recombinant DNA |
|
| Human IL-2 sequence |
GenBank |
GenBank: X00695.1
|
| Mouse IL-2 sequence |
GenBank |
GenBank: X01772.1
|
| pCT3CBN |
Derived from pCT302 (Boder and Wittrup, 1997) |
N/A |
| pCT3CBN_hIL2 (Yeast display vector for human IL-2) |
This manuscript |
N/A |
| pCT3CBN_mIL2 (Yeast display vector for mouse IL-2) |
This manuscript |
N/A |
| F5111 VH and VL sequence |
Rondon et al., 2015
|
N/A |
| F5111.2 VH and VL sequence |
Rondon et al., 2015
|
N/A |
| FITC-E2 VH and VL sequence |
Honegger et al., 2005
|
N/A |
| Human IgG1 constant heavy chain sequence |
ImMunoGeneTics (IMGT) |
IMGT: J00228
|
| Human IgG1 constant lambda chain sequence |
ImMunoGeneTics (IMGT) |
IMGT: J00253
|
| Human IL-2Rα sequence (1–217) |
GenBank |
GenBank: X01057.1
|
| Human IL-2Rβ sequence (1–214) |
GenBank |
GenBank: M26062.1
|
| gWiz High Expression Blank Vector |
Genlantis |
P000200 |
| gWiz_F5111_Ab_HC (Expression vector for F5111 heavy chain) |
This manuscript |
N/A |
| gWiz_F5111_Ab_LC (Expression vector for F5111 light chain) |
This manuscript |
N/A |
| gWiz_F5111.2_Ab_HC (Expression vector for F5111.2 heavy chain) |
This manuscript |
N/A |
| gWiz_F5111.2_Ab_LC (Expression vector for F5111.2 light chain) |
This manuscript |
N/A |
| gWiz_F5111_IC_LN15_LC (Expression vector for human IL-2 linked to F5111 light chain with a 15 amino acid linker) |
This manuscript |
N/A |
| gWiz_F5111_IC_LN25_LC (Expression vector for human IL-2 linked to F5111 light chain with a 25 amino acid linker) |
This manuscript |
N/A |
| gWiz_F5111_IC_LN35_LC (Expression vector for human IL-2 linked to F5111 light chain with a 35 amino acid linker) |
This manuscript |
N/A |
| gWiz_F5111_Ab_HC_Y35A (Expression vector for F5111 heavy chain with Y35A mutation) |
This manuscript |
N/A |
| gWiz_F5111_Ab_HC_Y52A (Expression vector for F5111 heavy chain with Y52A mutation) |
This manuscript |
N/A |
| gWiz_F5111_Ab_HC_Y54A (Expression vector for F5111 heavy chain with Y54A mutation) |
This manuscript |
N/A |
| gWiz_F5111_Ab_HC_Y60A (Expression vector for F5111 heavy chain with Y60A mutation) |
This manuscript |
N/A |
| gWiz_F5111_Ab_HC_V103A (Expression vector for F5111 heavy chain with V103A mutation) |
This manuscript |
N/A |
| gWiz_F5111_IC_LN35_LC_Y33A (Expression vector for human IL-2 linked to F5111 Y33A mutant light chain with a 35 amino acid linker) |
This manuscript |
N/A |
| gWiz_F5111_IC_LN35_LC_Y94A (Expression vector for human IL-2 linked to F5111 Y94A mutant light chain with a 35 amino acid linker) |
This manuscript |
N/A |
| gWiz_F5111_IC_LN35_LC_S96A (Expression vector for human IL-2 linked to F5111 S96A mutant light chain with a 35 amino acid linker) |
This manuscript |
N/A |
| gWiz_F5111.2_IC_LN35_LC (Expression vector for human IL-2 linked to F5111.2 light chain with a 35 amino acid linker) |
This manuscript |
N/A |
| gWiz_Control_IC_HC (Expression vector for FITC-E2 heavy chain) |
This manuscript |
N/A |
| gWiz_Control_IC_LN35_LC (Expression vector for human IL-2 linked to FITC-E2 light chain with 35 amino acid linker) |
This manuscript |
N/A |
| gWiz_F5111_Ab_HC_N297A (Expression vector for F5111 heavy chain with N297A mutation) |
This manuscript |
N/A |
| gWiz_F5111.2_Ab_HC (Expression vector for F5111.2 heavy chain with N297A mutation) |
This manuscript |
N/A |
| gWiz_F5111_Ab_HC_Y60A_N297A (Expression vector for F5111 heavy chain with Y60A and N297A mutations) |
This manuscript |
N/A |
| gWiz_F5111_Ab_HC_V103A_N297A (Expression vector for F5111 heavy chain with V103A and N297A mutations) |
This manuscript |
N/A |
| gWiz_Control_IC_HC_N297A (Expression vector for FITC-E2 heavy chain with N297A) |
This manuscript |
N/A |
| gWiz_hIL2 (Expression vector for human IL-2) |
This manuscript |
N/A |
| gWiz_hIL2_BH3 (Expression vector for human IL-2 with BH3 tag for biotinylation) |
This manuscript |
N/A |
| gWiz_hIL2Ra_BH3 (Expression vector for human IL-2Rα residues 1–217 with BH3 tag for biotinylation) |
This manuscript |
N/A |
| gWiz_hIL2Rb_BH3 (Expression vector for human IL-2Rβ residues 1–214 with BH3 tag for biotinylation) |
This manuscript |
N/A |
| gWiz_Trastuzumab_HC (Expression vector for trastuzumab heavy chain) |
This manuscript |
N/A |
| gWiz_Trastuzumab_LC (Expression vector for trastuzumab light chain) |
This manuscript |
N/A |
|
| Software and algorithms |
|
| GraphPad Prism 8.4.3 |
GraphPad |
https://www.graphpad.com/
|
| FlowJo v10.7.1 |
FlowJo, LLC |
https://www.flowjo.com/solutions/flowjo
|
| PyMOL v2.3.2 |
PyMOL |
https://pymol.org/2/
|
| BioRender |
BioRender |
https://biorender.com/
|
