| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit anti-calretinin (diluted 1:1000) | Swant | Cat: CR7699/3H; RRID: AB 10000321 |
| Chicken anti-GFP (diluted 1:3000) | Aves Labs | Cat: GFP-1020; RRID: AB_10000240 |
| Goat anti-Prox1 (diluted 1:300) | R&D systems | Cat: AF2727; RRID: AB_2170716 |
| Mouse anti-Reelin (CR-50, diluted 1:300) | MBL International | Cat: D223-3; RRID: AB_843523 |
| Goat anti mCherry (diluted in 1:125) | Antibodies-online | Cat: ABIN1440057; RRID: AB_2333093 |
| Rat anti-RFP (diluted 1:500) | ChromoTek | Cat: 5f8-100; RRID: AB_2336064 |
| Alexa Fluor 647 Streptavidin (diluted 1:500) | Jackson ImmunoResearch Labs | Cat: 016-600-084; RRID: AB_2341101 |
| Donkey anti-goat IgG (HL) Alexa Fluor 488 (diluted 1:500) | Molecular Probes | Cat: A-11055; RRID: AB_2534102 |
| Anti-chicken IgG (H + L) Alexa Fluor 488 (diluted 1:500) | Jackson ImmunoResearch Labs | Cat: 703-545-155; RRID: AB_2340375 |
| Donkey anti-rat IgG (H + L) Cy3 (diluted 1:500) | Jackson ImmunoResearch Labs | Cat: 712-165-150; RRID: AB_2340666 |
| Donkey anti-mouse IgG (H + L) Alexa Fluor 647 (diluted 1:500) | Molecular Probes | Cat: A-31571; RRID: AB_162542 |
| Donkey anti-rabbit IgG (H + L) AlexaFluor 647 (diluted 1:500) | Molecular Probes | Cat: A-31573; RRID: AB_2536183 |
| Rabbit anti-calretinin (diluted 1:1000) | Swant | Cat: CR7699/3H; RRID: AB_10000321 |
| Chicken anti-GFP (diluted 1:3000) | Aves Labs | Cat: GFP-1020; RRID: AB_10000240 |
| Goat anti-Prox1 (diluted 1:300) | R&D systems | Cat: AF2727; RRID: AB_2170716 |
| Bacterial and virus strains | ||
| AAV-hSyn-DIO-hM3Dq-mCherry (AAV8) | Krashes et al., (2011), Addgene | Cat: 44361 |
| AAV-hSyn-DIO-hM4Di-mCherry (AAV8) | Krashes et al., (2011), Addgene | Cat: 44362 |
| AAV-hSyn-GFP-Cre (AAV8) | UNC Vector Core | N/A |
| AAV-EF1a-DIO-shSlc18A2-mCerulean (AAV8) | This paper | N/A |
| AAV-EF1a-DIO-shLacZ-mCerulean (AAV8) | This paper | N/A |
| pCAG-DiO-mCerulean-WPRE | This paper | N/A |
| pAAV-EF1a-DiO-mCherry | A gift from Karl Deisseroth, Addgene | Cat: 20299 |
| Chemicals, peptides, and recombinant proteins | ||
| Clozapine-N-Oxide | Tocris | Cat:4936-10MG |
| Fluoxetine hydrochloride | Sigma-Aldrich | Cat: F132-10MG |
| Serotonin hydrochloride | Sigma-Aldrich | Cat: H9523-25MG |
| CNQX | Tocris | Cat: 0190 |
| DL-2-Amino-5-Phosphonovaleric acid (AP-V) | Sigma-Aldrich | Cat: A5282-50MG |
| Picrotoxin (PTX) | Tocris | Cat: 1128 |
| Bovine serum albumin (BSA) | Sigma-Aldrich | Cat: A8806 |
| Normal donkey serum | Sigma-Aldrich | Cat: S30-100ML |
| 4',6-Diamidine-2’-phenylindole dihydrochloride (DAPI) | Sigma-Aldrich | Cat: D9542 |
| Fast Green | Roche | Cat: 06402712001 |
| Isoflurane 100% inhalation vapor liquid | Piramal Critical Care Limited | N/A |
| Paraformaldehyde | Sigma-Aldrich | Cat: 441244 |
| Pentobarbital sodium (Euthatal) | Merial Animal Health Ltd | N/A |
| Triton X-100 | Sigma-Aldrich | Cat: T8787-100ML |
| 0.9% NaCl | Sigma-Aldrich | Cat: S76530 |
| Dulbecco's Modified Eagle Medium | Gibco | Cat: 21969-035 |
| Penicillin/Streptomycin | Gibco | Cat: 15140-122 |
| Critical commercial assays | ||
| ACDBio Multiplex Fluorescent Kit v2 | ACDBio | Cat: 323110 |
| Experimental Models: Cell lines | ||
| HEK293FT | ThermoScientific | Cat: R70007 |
| Experimental Models: Organisms/strains | ||
| Mice: NexCre/+ | Gift from K.A. Nave | MGI: 2668659 |
| Mice: Bak−/−;Baxfl/fl | The Jackson Laboratory | JAX: 006329; RRID: IMSR_JAX:006329 |
| Mice: Htr3a-Cre | Gensat | Cat: 037089-UCD RRID: MMRRC 037089-UCD |
| Mice: VipCre/+ | The Jackson Laboratory | Cat: 010908; RRID: IMSR JAX:010908 |
| Mice: RCLtdT/+ | The Jackson Laboratory | JAX: 007909; RRID: IMSR_JAX:007909 |
| Mice: CD1 | Charles River | Crl: CD1(ICR) |
| Mice: Slc17a7-/- (Vglut1-/-) | Fremeau et al., 2004 | MGI: 3617803 |
| Mice: Slc17a6fl/fl (Vglut2fl/fl) | Hnasko et al. (2010) | MGI: 4879093 |
| Mice: Fucci2fl/fl | Mort et al. (2014) | MGI: 5645798 |
| Oligonucleotides | ||
| FW primer for shSlc18a2 | CTAGGCAAGCTGATCCTGTTCAT CGCCTGACCCACGATGAACAGG ATCAGCTTGCTTTTTG |
|
| RV primer for shSlc18a2 | AATTCAAAAAGCAAGCTGATCCT GTTCATCGTGGGTCAGGCGATG AACAGGATCAGCTTGC |
|
| RNAScope® Probe-Mm-Slc18a2 | ACDBio | Cat: 425331 |
| RNAScope® Probe-MmSlc6A4 | ACDBio | Cat: 315851 |
| Software and algorithms | ||
| FIJI (ImageJ) | National Institute of Health | https://fiji.sc/; https://imagej.nih.gov/ij/index.html; RRID: SCR_003070 |
| MATLAB | MathWorks | https://www.mathworks.com/products/matlab.html; RRID: SCR_001622 |
| LAS AF | Leica Microsystems | https://www.leica-microsystems.com/; RRID: SCR_013673 |
| Stereo Investigator | MBF Biosciences | https://www.mbfbioscience.com/stereo-investigator; RRID: SCR_018948 |
| Other | ||
| P-2000 micropipette puller | Sutter Instrument | https://www.leicabiosystems.com/histology-equipment/microtomes/ |
| ZEISS Apotome 2 | ZEISS | https://www.zeiss.com/microscopy |
| Leica TCS-SP8 confocal | Leica | https://www.leica-microsystems.com/ |
| LightCycler® 96 | Roche Life Science | N/A |
| Optima-L100 XP | Beckman-Coulter | N/A |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.