Molecular Detection of gyrA Mutation in Clinical Strains of Klebsiella pneumoniae

Abstract

Background:

Multi-drug resistant (MDR) Klebsiella pneumoniae strains cause the majority of community acquired and life-threatening infections. We aimed to detect the gyrA mutations in the clinical strains of nalidixic acid and ciprofloxacin resistant K. pneumoniae isolated from the patients with urinary tract infections.

Methods:

Bacterial strains were isolated from the patients with urinary tract infections admitted to a major hospital in Tehran, Iran (2017–2018). Bacterial identification was done according to standard microbiological tests. Antimicrobial susceptibility testing for quinolones and fluoroquinolone antibiotics was done using both disc diffusion and minimal inhibitory concentrations (MICs) methods. PCR-RFLP was used to detect the probable mutation in the gyrA gene in nalidixic acid and ciprofloxacin resistant strains. Finally sequencing was performed to detect point mutations in isolated K. pneumoniae strains.

Results:

One hundred K. pneumonia isolates were recovered from the urine samples of the clinical cases. Antibiotic resistance testing showed that among all K. pneumoniae isolates, 26% and 19% of the strains were resistant to nalidixic acid and ciprofloxacin respectively. MIC value was ≥4 μg/ml for ciprofloxacin resistant isolates. The results of RFLP on gyrA PCR amplicons using HinfI restriction enzyme showed point mutation in this gene in 46% of nalidixic acid and ciprofloxacin resistant K. pneumonia. The data obtained from the sequencing confirmed the RFLP results and indicated the presence of point mutations in codons 83 and 87 in the gyrA gene which leads to the substitution of different amino acids in gyrA protein.

Conclusion:

Our findings indicated a relative increased rate of resistance against quinolones and fluoroquinolone antibiotics that raised a concern about extensive dissemination of clinical strains of nalidixic acid and ciprofloxacin resistant K. pneumonia. Point mutation of gyrA gene was responsible for the resistance in our strains however to gain more insight into the molecular characterization of quinolone-resistant isolates, other possible mechanisms of the resistance should also be investigated.

Introduction

Klebsiella pneumoniae is a gram negative and rod-shaped bacillus from the genus Klebsiella and family Enterobacteriaceae. As a nosocomial pathogen, it causes several serious infections including pneumonia, bacteremia, hepatic abscesses and urinary tract infections particularly in the patients with underlying disease such as diabetes mellitus (1, 2).

Because of rapid emergence and spread of antibiotic resistance between the bacteria, there is an urgent need to monitor the use of antimicrobial agents and modify antibiotic therapies. Antibiotic resistance in bacteria is caused by several mechanisms including mutations in the genetic materials of bacterial cells. There are many reports through the world in which clinical isolates of K pneumoniae have shown resistance to multiple antibiotic including quinolones and fluoroquinolones (3–5). The resistance against quinolones is often originated from chromosomes due to mutation of DNA gyrase gene. This enzyme consists of four subunits; a sub-unit is the main target of quinolone group antibiotics (3, 6). Unlike to abundance of global studies on quinolones and fluoroquinolones resistant K. pneumoniae, a few reports from Iran have shown the frequency of these resistance types and their genetic natures in clinical isolates of K. pneumoniae (6–10). Therefore, it is very important to continue studying the genes responsible for the resistance to different antibiotics in this pathogen particularly those are involved in quinolone resistance.

This study aimed to determine the frequency of resistance of clinical strains of K. pneumoniae toward quinolones and fluoroquinolons antibiotics. Moreover the genetic mutation in gyrA was also investigated.

Materials and Methods

Bacterial strains

In a cross-sectional study carried out in 2017 to 2018, K. pneumoniae isolates were recovered from the patients admitted to a major hospital in Tehran, Iran. The bacterial isolates were identified using conventional phenotypic and biochemical methods.

Antibiotics susceptibility testing

The antibiotic susceptibility testing of clinical K. pneumoniae isolates to fluoroquinolons (ciprofloxacin, 50 μg) and quinolone (nalidixic acid, 30 μg) was done using standard disk diffusion by culturing the isolates on the Mueller-Hinton agar medium and incubation for 18–24 h at 37 °C. The diameters of the antibiogram growth inhibition zones were measured according to the CLSI guidelines and the strains were classified based on how they reacted to each drug into susceptible and resistant (11).

The minimal inhibitory concentrations (MICs) was also carried out for ciprofloxacin by VITEK2 compact system (Biomerieux, Marcy, PE-toile, France). Standard strain K. pneumoniae ATCC 12022 was used as a control.

Molecular detection of gyrA mutations

Total DNA was extracted by modified boiling method. The premiers’ gyrAF (CGCGTACTATACGCCATGAACGTA) and gyrAR (ACCGTTGATCACTTCGGTCAGG) were used for amplification of target gene of gyrA (12). Amplification reaction was performed according to the manufacturer's instructions, in an Eppendorf thermal cycler (Germany) in a reaction mixture (25μl) contained 10 μl Mastermix, 12 μl distilled water, 10 pmol of primer, and 1 μl DNA template. The PCR conditions for amplification of gyrA included an initial denaturation at 94–98 °C for 5 min, 35 cycles of denaturation at 94 °C for 1 min, 1 min of annealing at 65 °C, and 2 min of extension at 72 °C, and final extension at 72 °C for 5 min. The PCR products were analyzed by electrophoresis on 1% gel agarose containing the safe stain.

RFLP analysis was used to determine the probable mutation in the gyrA gene of nalidixic acid and ciprofloxacin resistant strains. PCR products of gyrA gene was digested with HinfI enzyme. Briefly, 12 μl of PCR-amplified fragment was digested with 5 unit of the HinfI enzyme (MBI Fermentas) in 3 μl digestion buffer in final volume of 20 μl, and incubated at 37 °C for 16 h. Then, the restriction fragments were analyzed by electrophoresis on 2% agarose gel. Finally the sequencing was done to detect the point mutations in K. pneumoniae strains. The obtained data were blasted in NCBI, and analyzed by Alignment Tools Pairwise software.

Ethical approval

This study was reviewed and approved by Nationnal Institute for Medical Research Development, Tehran, IRAN (ethic ID: IR.NIMAD 1398.172).

Results

Overall, 100 clinical isolates of K. pneumoniae were recovered from the patients under the study. Fifty seven patients were males and forty three were female. The age range of the patients was from 30 to 88 years. All bacterial strains were isolated from the urine specimens.

Antibiotic resistance testing showed that among all K. pneumoniae isolates, 26% and 19% of the strains were resistant to nalidixic acid and ciprofloxacin respectively. MIC value was ≥ 4 μg/ml for ciprofloxacin resistant isolates. The most of the quinolone and fluoroquinolone resistant strains exhibited a low cip MIC value (4 μg/mL). The gyrA gene was amplified successfully in all nalidixic acid and ciprofloxacin resistant strains by PCR to produce amplicon products with expected size (Fig. 1). The results of RFLP using HinfI restriction enzyme showed point mutation in 46% of nalidixic acid and ciprofloxacin resistant K. pneumonia isolates. As shown in Fig. 2, PCR-amplified gyrA fragments from non-mutant had three digested DNA bands however in mutant strains two fragments were produced.

Fig. 1:

PCR amplification of gyrA gene in K. pneumonia strains

Fig. 2:

Restriction fragment length polymorphism patterns of amplified gyrA gene in some representative strains of K. pneumonia using HinfI restriction enzyme. Lanes 1–4 are mutant isolates with 2 fragments. Lane 5 is a non mutant isolate. MW is a 100bp DNA size marker

The sequencing of representative samples showed the presence of point mutations in codons 83 and 87 in the gyrA gene which leads to the substitution of different amino acids in gyrA protein. A double mutation in gyrA gene was identified in two strains.

Discussion

Many previous studies have reported that the K. pneumonia strains were still susceptible to the fluoroquinolones indicated that these antibiotics might be considered as alternative and effective drug for treatment of the infections caused by this organism. However K. pneumoniae strains isolated in our study showed 26% and 19% resistance rates against nalidixic acid and ciprofloxacin respectively.

In our previous report with similar setting in 2016, 27% of the K. pneumoniae strains were resistant to these antibiotic classes (13). In Iran, low or moderate rates of resistance was indicated to quinolones in K. pneumoniae isolates. A very low frequency (6.8%) of the resistance reported to at least one of the quinolones among 220 K. pneumoniae isolates (7). Low frequency of resistance against nalidixic acid (29%) and ciprofloxacin (27%) in K. pneumoniae was also reported (9). Recently, among 100 isolates recovered in Borujerd hospitals, 38% of the K. pneumoniae strains were resistant to nalidixic acid and ciprofloxacin (6). Moreover, 39% and 27% of K. pneumoniae strains were resistant against nalidixic acid and ciprofloxacin respectively (10).

Comparison of the results obtained from previous studies in our country indicates that the resistance of K. pneumonia strains toward quinolones and fluoroquinolone antibiotics is increasing. This alarming situation has been reported in other Asian countries. For example, the resistance rates for quinolones or fluoroquinolone antibiotics among K. pneumoniae strains have been reported 95% in Korea (14), 60%–80% in China (15,16) and 62.8% in Iraq (17).

By PCR, the desired gyrA DNA band was amplified in all resistant strains. RFLP was used to molecular analysis of quinolones or fluoroquinolone resistant K. pneumoniae strains. To detect the mutation in the gyrA, PCR products of gyrA were digested by HinfI restriction enzyme. Generally the target gyrA gene contains HinfI restriction sites that one of them is located at the codon 83 serine. RFLP with this enzyme will produce three fragments in non-mutant isolates. However, in mutant strains 2 fragments are expected to be produced due to loss of the restriction site at codon 83 serine. We found that 66% of nalidixic acid and ciprofloxacin resistant K. pneumonia isolates had an altered restriction site at the codon 83 serine.

In the most reports, this mutation has been resulted in replacement of the amino acid of serine to phenylalanine (Ser83→Phe), serine to tyrosine (Ser83→Tyr), serine to leucine (Ser83→Leu) and other amino acid substitutions (3, 6, 7, 9).

The data obtained from the sequencing confirmed the RFLP results and indicated the presence of point mutations in codons 83 and 87 in the gyrA gene which leads to the substitution of different amino acids in gyrA protein.

In a recent study in Iran, the mutation rate of 40% in gyrA gene was in quinolone-resistant K. pneumoniae strains (6). Norouzi et al. reported substitution of Ser 83 →Ile and Ser 83 →Phe in gyrA gene among their K. pneumoniae strains (10). In Iraq, Ser83 → Leu was the most common mutation in gyrA that was observed in all quinolone resistant K. pneumoniae isolates, followed by Asp87→Asn (17). In China, more than 95% of ciprofloxacin resistant Klebsiella had point mutations in gyrA (16).

As a limitation, we didn’t check other possible mechanisms of quinolone resistance including the mutation of parC gene and the presence of various qnr genes on the plasmids. As aforementioned, 46% of nalidixic acid and ciprofloxacin resistant K. pneumonia isolates had point mutations in gyrA indicating other possible mechanisms may be involved to confer resistance toward quinolone resistance in our isolates including the changes in the endocytic pathways, decreasing porin-expressions, increasing efflux pumps, and obtaining the qnr plasmids. Our findings showed a comparable rate of mutations in gyrA responsible for resistance against quinolones and fluoroquinolones in our K. pneumonia isolates.

Here, we reported a relative increased rate of resistance against quinolone and fluoroquinolone antibiotics among K. pneumoniae strains. Acquisition of the virulence-associated genes encoding antibiotic resistance, biofilm formation and efflux pump by this organism can be a considered as a major challenge for treatment of K. pneumoniae related infections and poses an important health issue in clinical settings (18).

Conclusion

Compared to previous studies, our findings indicated an increased rate of resistance against quinolones and fluoroquinolone antibiotics that raises a concern about extensive dissemination of clinical strains of nalidixic acid and ciprofloxacin resistant K. pneumonia. Point mutation of gyrA gene was responsible for the resistance in our strains however to gain more insight into the molecular characterization of quinolone-resistant isolates, other possible mechanisms of resistance should also be investigated.

Journalism Ethics considerations

Ethical issues (Including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc.) have been completely observed by the authors.