REAGENT or RESOURCE	SOURCE	IDENTIFIER
Chemicals, peptides, and recombinant proteins
Spot-Tag Experiment Spot-Tag∗ (peptide target) target called Spot-Tag.O1 (N-terminus)-PDRVRA VSHWSSGGG-Cys (C-terminus)-3′ATCCCTTCTCTTCC TGTATACTAATAGGTGCACGTAGATTC/5Phos/	Hong et al., 2022
Spot-Tag Experiment Bradykinin∗ (peptide target control for non-specific binding) target called Brady.O1 (N-terminus)-RPPGFSPFR-Cys (C-terminus)-3′ATCC CTTCTCTTCCTGTATACTAATAGGTGCACGTA GATTC/5Phos/	Hong et al., 2022
EcoRI	NEB	Cat#R0101S
Cutsmart buffer	NEB	Cat#B6004
Hybridization buffer (0.025% TWEEN20 in no 1× PBS)	This paper
Blocking buffer (0.025% TWEEN20 in 1× PBS + 10 mg/mL BSA)	This paper
Chip blocking buffer (10 μM of P5 Complementary oligo (5′-TCTCGGTGGTCGCCGTATCATT-3′)/P7 Complementary oligo (5′-ATCTCGTATGCCGTCT TCTGCTTG-3′) sequences + 10 μM POC Tail blocking sequence (5′-TAGGGAAGAGAAGGACATATGATTATCC ACGTGCATCTAAG-3′) in 60 μL of Blocking Buffer)	This paper
Incubation buffer (0.025% TWEEN20 in 1× PBS + 0.1 mg/mL BSA)	This paper
Bovine serum albumin (BSA)	Sigma-Aldrich	A2153-50G
Phosphate buffered saline (PBS)	Thermo Fisher Scientific	AM9624
TWEEN20	Sigma-Aldrich	P9416
SimplyBlue SafeStain	Thermo Fisher Scientific	LC6060
Glycerol	Sigma-Aldrich	G5516-500ML
Formamide	Sigma-Aldrich	11814320001
T4 DNA ligase	NEB	M0202S
HT1 buffer	Illumina	20015892
70% ethanol	Fisher Scientific	BP8201-500
Critical commercial assays
MiSeq Reagent Nano Kit v2 (300-cycles)	Illumina	MS-103-1001
MiSeq Reagent Nano Kit v2 (500 cycles)	Illumina	MS-103-1003
Miseq Reagents Kits v2 (50 Cycles)	Illumina	MS-102-2001
MiSeq® Reagent Kit v3 (150 cycle)	Illumina	MS-102-3001
PhiX Control v3	Illumina	FC-110-3001
Blunt/TA Ligase Master Mix	NEB	Cat#M0367L
SoluLINK Protein-Oligonucleotide Conjugation Kit	Vector Laboratories	S-9011-1
Deposited data
Raw sequencing data for BCS	Mendeley	https://data.mendeley.com/datasets/f9hdn5xc3v/1
Oligonucleotides
All oligonucleotide sequences are listed throughout the protocol where relevant	This paper	N/A
Software and algorithms
MiSeq Control Software	Illumina	https://www.illumina.com/systems/sequencing-platforms/miseq/products-services/miseq-control-software.html
Colab	Google	https://colab.research.google.com/
Custom analysis code	GitHub	https://github.com/google-research/google-research/tree/master/protseq
Other
MiSeq 500	Illumina	SY-410-1003
1.5 mL microfuge tubes, DNA LoBind	Eppendorf	cat#022431021
96-well plates, DNA Lo-Bind	Eppendorf	0030129512
Mastercycler® nexus gradient, 115 V/50–60 Hz (US)	Eppendorf	6331000025
Mastercycler® nexus eco, 115 V/50–60 Hz (US)	Eppendorf	6332000029
Mastercycler® nexus flat eco, 110 V/50–60 Hz (JP/South America/TW/US)	Eppendorf	6330000021
Adhesive PCR Plate Seals	Thermo Fisher Scientific	AB0558