Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Goat polyclonal anti-AP-2 gamma | R&D Systems | Cat# AF5059, RRID: AB_2255891 |
| Mouse monoclonal anti-AP-2gamma | Santa Cruz Biotechnology | Cat# sc-12762, RRID: AB_667770 |
| Goat polyclonal anti-Brachyury | R&D Systems | Cat# AF2085, RRID: AB_2200235 |
| Mouse monoclonal anti-Cdx2 | BioGenex | Cat# MU392-UC, RRID: AB_2335627 |
| Rabbit monoclonal anti-Cdx2 | Abcam | Cat# ab76541, RRID: AB_1523334 |
| Rat monoclonal anti-Cerberus 1 | R&D Systems | Cat# MAB1986, RRID: AB_2275974 |
| Goat polyclonal anti-Dkk1 | R&D Systems | Cat# AF1096, RRID: AB_354597 |
| Rat monoclonal anti-E-Cadherin | Thermo Fisher Scientific | Cat# 13–1900, RRID: AB_2533005 |
| Rabbit polyclonal anti-TBR2 / Eomes | Abcam | Cat# ab23345, RRID: AB_778267 |
| Rabbit monoclonal anti-FoxA2 / HNF3 | Cell Signaling Technology | Cat# 8186, RRID: AB_10891055 |
| Rabbit polyclonal anti-GATA-4 | Santa Cruz Biotechnology | Cat# sc-9053, RRID: AB_2247396 |
| Goat polyclonal anti-GATA-6 | R&D Systems | Cat# AF1700, RRID: AB_2108901 |
| Rat monoclonal anti-GFP | Nacalai Tesque | Cat# GF090R, RRID: AB_2314545 |
| Mouse monoclonal anti-eHAND | Santa Cruz Biotechnology | Cat# sc-390376 |
| Rabbit polyclonal anti-Keratin18 | Sigma-Aldrich | Cat# SAB4501665, RRID: AB_10746153 |
| Goat polyclonal anti-Lefty | R&D Systems | Cat# AF746, RRID: AB_355566 |
| Mouse monoclonal anti-Myh2 | R&D Systems | Cat# MAB4470, RRID: AB_1293549 |
| Mouse monoclonal anti-N-Cadherin | BD Biosciences | Cat# 610920, RRID: AB_2077527 |
| Goat polyclonal anti-Nkx2.5 | R&D Systems | Cat# AF2444, RRID: AB_355269 |
| Mouse monoclonal anti-Oct-3/4 | Santa Cruz Biotechnology | Cat# sc-5279, RRID: AB_628051 |
| Goat polyclonal anti-Otx2 | R&D Systems | Cat# AF1979, RRID: AB_2157172 |
| Rabbit polyclonal anti-RFP | Rockland | Cat# 600–401-379, RRID: AB_2209751 |
| Rabbit monoclonal anti-RUNX1 / AML1 | Abcam | Cat# ab92336, RRID: AB_2049267 |
| Rabbit polyclonal anti-Sox1 | Cell Signaling Technology | Cat# 4194, RRID: AB_1904140 |
| Mouse monoclonal anti-Sox2 | Santa Cruz Biotechnology | Cat# sc-365823, RRID: AB_10842165 |
| Rat monoclonal anti-Sox2 | Thermo Fisher Scientific | Cat# 14–9811-82, RRID: AB_11219471 |
| Goat polyclonal anti-Sox17 | R&D Systems | Cat# AF1924, RRID: AB_355060 |
| Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Thermo Fisher Scientific | Cat# A-21202, RRID: AB_141607 |
| Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Thermo Fisher Scientific | Cat# A-21206, RRID: AB_2535792 |
| Donkey anti-Goat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 | Thermo Fisher Scientific | Cat# A-11055, RRID: AB_2534102 |
| Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 | Thermo Fisher Scientific | Cat# A10037, RRID: AB_2534013 |
| Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 | Thermo Fisher Scientific | Cat# A10042, RRID: AB_2534017 |
| Donkey anti-Goat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 | Thermo Fisher Scientific | Cat# A-11057, RRID: AB_2534104 |
| Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 | Thermo Fisher Scientific | Cat# A-31571, RRID: AB_162542 |
| Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 | Thermo Fisher Scientific | Cat# A-31573, RRID: AB_2536183 |
| Donkey anti-Goat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647 | Thermo Fisher Scientific | Cat# A-21447, RRID: AB_2535864 |
| Donkey Anti-Rat IgG H&L (Alexa Fluor® 647) preadsorbed antibody | Abcam | Cat# ab150155, RRID: AB_2813835 |
| Bacterial and virus strains | ||
| 5-alpha competent E. coli | New England Biolabs | C2987I |
| Chemicals, peptides, and recombinant proteins | ||
| β-estradiol | Sigma-Aldrich | Cat# E8875–1G |
| CHIR99021 | Cambridge Stem Cell Institute | N/A |
| Doxycycline | Sigma-Aldrich | Cat# D9891–5G |
| Fgf2 | Cambridge Stem Cell Institute | N/A |
| Recombinant Mouse FGF-4 (aa 67–202) | R&D Systems | Cat# 7486-F4–025 |
| Heparin | Sigma-Aldrich | Cat# H3149–25KU |
| Insulin-transferrin-selenium-ethanolamine | ThermoFisher Scientific | Cat# 51500–056 |
| Leukaemia inhibitory factor | Cambridge Stem Cell Institute | N/A |
| N-acetyl-L-cysteine | Sigma-Aldrich | Cat# A7250 |
| PD0325901 | Cambridge Stem Cell Institute | N/A |
| Progesterone | Sigma-Aldrich | Cat# P8783–1G |
| Y-27632 | STEMCELL Technologies |
Cat# 72304 |
| Critical commercial assays | ||
| Gateway™ BP Clonase™ II Enzyme mix | Invitrogen | Cat# 11789–100 |
| Gateway™ LR Clonase™ II Enzyme mix | Invitrogen | Cat# 11791–100 |
| Lipofectamine™ 3000 Transfection Reagent | Invitrogen | Cat# L3000001 |
| RNeasy Mini Kit | Qiagen | Cat# 74104 |
| SYBR Green PCR Master Mix | Applied Biosystems | Cat# 4368708 |
| Deposited data | ||
| Single-cell RNA sequencing data | This manuscript | ArrayExpress: E-MTAB-12140 |
| Code for analysing single-cell RNA sequencing data | This manuscript | DOI: 10.5281/zenodo.7021607 |
| Experimental models: Cell lines | ||
| Mouse: CAG-GFP ESCs | Rhee et al., 2006 | N/A |
| Mouse: CAG-GFP/tetO-mCherry/tetO-Cdx2 ESCs | This manuscript | N/A |
| Mouse: CAG-GFP/tetO-mCherry/tetO-Gata4 ESCs | Amadei et al., 2021 | N/A |
| Mouse: Cerl-GFP/tetO-Gata4 ESCs | Amadei et al., 2021 | N/A |
| Mouse: CD1 ESCs | Prof Jennifer Nichols (Stem Cell Institute, University of Cambridge, UK) | N/A |
| Mouse: CD1/tetO-Gata4 ESCs | Amadei et al., 2022 | N/A |
| Mouse: Confetti TSCs | Prof Jennifer Nichols (Stem Cell Institute, University of Cambridge, UK) | N/A |
| Mouse: mT/mG mouse ESCs | Muzumdar et al., 2007 | N/A |
| Mouse: Sox2-Venus/Brachyury-mCherry/Oct4-Venus mouse ESCs | Dr Jesse Veenvliet and Prof Bernhard G. Herrmann (Max Planck Institute of Molecular Cell Biology and Genetics) | N/A |
| Experimental models: Organisms/strains | ||
| Mouse: CD-1 | Charles River Laboratories | N/A |
| Oligonucleotides | ||
| PCR primer: Cdx2-attB forward: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGTACGTGAGCTACCTTCTGGAC | This manuscript | N/A |
| PCR primer: Cdx2-attB reverse: GGGGACCACTTTGTACAAGAAAGCTGGGTTTCACTGGGTGACAGTGGAGTTTAAAAC | This manuscript | N/A |
| qPCR primer: Cdx2 forward: AAACCTGTGCGAGTGGATG | Blij et al., 2012 | N/A |
| qPCR primer: Cdx2 reverse: TCTGTGTACACCACCCGGTA | Blij et al., 2012 | N/A |
| qPCR primer: Elf5 forward: ATTTCTACAGTCCGCTGGTGC | This manuscript | N/A |
| qPCR primer: Elf5 reverse: ACATCACCGTGAAGACAAGTGG | This manuscript | N/A |
| qPCR primer: Gapdh forward: CGTATTGGGCGCCTGGTCAC | Amadei et al., 2021 | N/A |
| qPCR primer: Gapdh reverse: ATGATGACCCTTTTGGCTCC | Amadei et al., 2021 | N/A |
| qPCR primer: Gata3 forward: TGTCTGCGAACACTGAGCTG | This manuscript | N/A |
| qPCR primer: Gata3 reverse: CGATCACCTGAGTAGCAAGGAG | This manuscript | N/A |
| Recombinant DNA | ||
| PB-tetO-hygro | Dr José Silva (Stem Cell Institute, University of Cambridge, UK) | N/A |
| pBAse | Dr José Silva (Stem Cell Institute, University of Cambridge, UK) | N/A |
| rtTA-zeocyin | Dr José Silva (Stem Cell Institute, University of Cambridge, UK) | N/A |
| Software and algorithms | ||
| Fiji | Schindelin et al., 2012 | https://imagej.net/Fiji |
| metacell_0.3.7 | Baran et al., 2018 | https://github.com/tanaylab/metacell |
| Metacells 0.9.0-dev.1 | Ben-Kiki et al., 2022 | https://github.com/tanaylab/metacells#id3 |
| Prism 8 | GraphPad | https://www.graphpad.com/scientific-software/prism/ |
| RStudio | RStudio | https://www.rstudio.com/ |
| Smart Denoise | Gurdon Institute | N/A |
| Other | ||
| AggreWell400 | STEMCELL Technologies |
Cat# 34415 |
| Anti-Adherence Rinsing Solution | STEMCELL Technologies |
Cat# 07010 |
| FACSAria III | BD Biosciences | N/A |
| Human cord serum | Cambridge Blood and Stem Cell Biobank | N/A |
| Knockout serum replacement | Gibco | Cat# 10828010 |
| Leica SP5 | Leica Microsystems | N/A |
| Leica SP8 | Leica Microsystems | N/A |
| M-MuLV Reverse Transcriptase | New England Biolabs | Cat# M0253S |
| Non-adherent 6 well multiwell plate | Greiner Bio-One | Cat# 657185 |
| 48-well multi-well plate | Greiner Bio-One | Cat# 677102 |
| Rat serum | Charles River Laboratories | N/A |
| StepOnePlus™ Real-Time PCR System | Applied Biosystems | N/A |
| TRIzol Reagent | Invitrogen | Cat# 15596026 |