| Antibodies |
| Mouse anti-STAT1 Clone C-111 |
Santa Cruz Biotechnology |
Cat No. sc417 |
| Rabbit anti-STAT2 |
Millipore Sigma |
Cat No. 06502 |
| Rabbit anti-phospho-Tyr 701-STAT1 Clone 58D6 |
Cell Signaling Technology |
Cat No. 9167 |
| Rabbit anti-phospho-Tyr-689-STAT2 Clone D3P2P |
Cell Signaling Technology |
Cat No. 88410 |
| Rabbit anti-USP18 Clone D4E7 |
Cell Signaling Technology |
Cat No. 4813 |
| Rabbit anti-β-actin Clone AC026 |
ABclonal |
Cat No. AC026 |
| Mouse anti-GAPDH Clone 6C5 |
Millipore |
Cat No. MAB374 |
| Rabbit anti-IFIT1 Clone D2X9Z |
Cell Signaling Technology |
Cat No. 14769 |
| Rabbit polyclonal anti-MX1 |
Abcam |
Cat No. ab95926 |
| Rabbit polyclonal anti-SOCS1 |
Thermo Fisher Scientific |
Cat No. PA5-27239 |
| Goat anti-mouse IgG HRP-conjugated |
Southern Biotech |
Cat No. 101005 |
| Goat anti-rabbit IgG HRP-conjugated |
Southern Biotech |
Cat No. 403005 |
| anti-CD16 AF647-conjugated Clone 3G8 |
Biolegend |
Cat No. 302023 |
| anti-CD56 BV711-conjugated Clone 5.1H11 |
Biolegend |
Cat No. 362541 |
| anti-CD19 AF700-conjugated Clone HIB19 |
Biolegend |
Cat No. 302225 |
| anti-CD14 AF488-conjugated Clone M5E2 |
Biolegend |
Cat No. 301811 |
| anti-CD3 BV510-conjugated Clone OKT3 |
Biolegend |
Cat No. 317331 |
| anti-Stat1 (pY701) PE-conjugated, Clone 4A |
BD |
Cat No. 612564 |
| anti-IFNAR1, Clone MARI-5A3 |
Millipore Sigma |
Cat. No. 04-151 |
| Anti-IFNAR1, Clone AA3 |
Laboratory of Sandra Pellegrini |
N/A |
| anti-IFNAR2, Clone MMHAR-2 |
PBL |
Cat No. 21385-1 |
| rat anti-mouse IgG (H+L), biotin conjugated |
Thermo Fisher |
Cat No. 13-4013-85 |
| Streptavidin, PE-conjugated |
Thermo Fisher |
Cat No. S866 |
| anti-CD45 89Y-conjugated Clone HI30 |
Fluidigm |
Cat No.3089003B |
| anti-CD57 113In-conjugated Clone HCD57 |
Biolegend |
Cat No.322302 |
| anti-CD11c 115In-conjugated Clone Bu15 |
Biolegend |
Cat No.337202 |
| anti-IgD 141Pr-conjugated Clone IA6-02 |
Biolegend |
Cat No.348202 |
| anti-CD19 142Nd-conjugated Clone HIB19 |
Biolegend |
Cat No.302202 |
| anti-CD45RA 143Nd-conjugated Clone HI100 |
Biolegend |
Cat No.304102 |
| anti-CD141 144Nd-conjugated Clone M80 |
Biolegend |
Cat No.344102 |
| anti-CD4 145Nd-conjugated Clone RPA-T4 |
Biolegend |
Cat No.300502 |
| anti-CD8 146Nd-conjugated Clone RPA-T8 |
Biolegend |
Cat No.301002 |
| anti-CD20 147Sm-conjugated Clone 2H7 |
Biolegend |
Cat No.302302 |
| anti-CD16 148Nd-conjugated Clone 3G8 |
Biolegend |
Cat No.302014 |
| anti-CD127 149Sm-conjugated Clone A019D5 |
Fluidigm |
Cat No.3149011B |
| anti-CD1c 150Nd-conjugated Clone L161 |
Biolegend |
Cat No.331502 |
| anti-CD123 151Eu-conjugated Clone 6H6 |
Biolegend |
Cat No.306002 |
| anti-CD66b 152Sm-conjugated Clone G10F5 |
Biolegend |
Cat No.305102 |
| anti-CD86 154Sm-conjugated Clone IT2.2 |
Biolegend |
Cat No.305410 |
| anti-CD27 155Gd-conjugated Clone O323 |
Biolegend |
Cat No.302802 |
| anti-CD33 158Gd-conjugated Clone WM53 |
Biolegend |
Cat No.303402 |
| anti-CD24 159Tb-conjugated Clone ML5 |
Biolegend |
Cat No.311102 |
| anti-CD14 160Gd-conjugated Clone M5E2 |
Biolegend |
Cat No.301810 |
| anti-CD56 161Dy-conjugated Clone B159 |
BD Biosciences |
Cat No.555513 |
| anti-CD169 162Dy-conjugated Clone 7-239 |
Biolegend |
Cat No.346002 |
| anti-CD69 164Dy-conjugated Clone FN50 |
Biolegend |
Cat No.310902 |
| anti-CD64 165Ho-conjugated Clone 10.1 |
Biolegend |
Cat No.305047 |
| anti-CD3 168Er-conjugated Clone UCHT1 |
Biolegend |
Cat No.300402 |
| anti-CD38 170Er-conjugated Clone HB-7 |
Biolegend |
Cat No.356602 |
| anti-CD161 171Yb-conjugated Clone HP-3G10 |
Biolegend |
Cat No.339902 |
| anti-HLADR 174Yb-conjugated Clone L243 |
Biolegend |
Cat No.307602 |
| anti-pSTAT5 147 Sm-conjugated Clone 47 |
Fluidigm |
Cat No.3147012A |
| anti-pSTAT6 149 Sm-conjugated Clone 18/P-Stat6 |
Fluidigm |
Cat No.3149004A |
| anti-pSTAT1 153 Eu-conjugated Clone 4a |
Fluidigm |
Cat No.3153005A |
| anti-pp38 156 Gd-conjugated Clone D3F9 |
Fluidigm |
Cat No.3156002A |
| anti-pSTAT3 158 Gd-conjugated Clone 4/P-Stat3 |
Fluidigm |
Cat No.3158005A |
| anti-pMAPKAP2 159 Tb-conjugated Clone 27B7 |
Fluidigm |
Cat No.3159010A |
| anti-STAT3 165 Ho-conjugated Clone 124H6 |
Fluidigm |
Cat No.3173003A |
| anti-STAT1 169 Tm-conjugated Clone 10C4B40 |
Biolegend |
Cat No.661002 |
| anti-pERK 171 Yb-conjugated Clone D13.14.4E |
Fluidigm |
Cat No.3171010A |
| anti-pS6 175 Lu-conjugated Clone N7-548 |
Fluidigm |
Cat No.3175009A |
| anti-Flavivirus Group Antigen, Clone D1-4G2-4-15 |
Millipore |
MAB10216 |
| Goat anti Mouse IgG (H+L) Secondary Antibody, Alexa Fluor 647 |
Thermo Fisher |
Cat No. A21235 |
| Bacterial and Virus Strains |
| DH5-Alpha Competent E. Coli |
Molecular Cloning Laboratories |
Cat No. DA-196 |
| PR8-GFP, Influenza A/PR/8/34 (PR8) virus (H1N1) |
Laboratory of Adolfo Garcia-Sastre |
N/A |
| ZIKV, strain PRVABC59, GenBank: KU501215.1
|
Laboratory of Matthew Evans |
N/A |
| Biological Samples |
| Human whole blood samples |
Various institutions |
N/A |
| HC-derived primary dermal fibroblasts |
ATCC |
Cat No. CRL2088 |
| HC-derived primary dermal fibroblasts |
Coriell institute |
Cat No. GM03440, GM08447 |
| DS-derived primary dermal fibroblasts |
ATCC |
Cat No. CCL54 |
| DS-derived primary dermal fibroblasts |
Coriell institute |
Cat No. AG08942, GM04616 |
| Chemicals, Peptides, and Recombinant Proteins |
| Intron-A Recombinant Interferon Alpha-2b |
Merck Pharmaceuticals |
Cat No. NDC0085057102 |
| Proteomic Stabilizer Prot1 |
SMART TUBE Inc |
Cat No. 501351691 |
| Heparin |
Sigma |
Cat No. 201060 |
| Osmium tetroxide (99.9%) |
ACROS organics |
Cat No. 191180010 |
| Discovery Ultra antibody block |
Roche |
Cat No. 760-4204 |
| Pierce ECL Western Blotting Substrate |
Thermo Fisher Scientific |
Cat No. 32106 |
| Pierce SuperSignal West Pico PLUS Chemiluminescent Substrate |
Thermo Fisher Scientific |
Cat No. 34580 |
| RIPA Lysis and Extraction Buffer |
Thermo Fisher Scientific |
Cat No. 89901 |
| Protease/Phosphatase Inhibitor Cocktail |
Cell Signaling Technologies |
Cat No. 5872 |
| Macherey-Nagel RNA Isolation, RA1 Lysis Buffer |
Thermo Fisher Scientific |
Cat No. 10335832 |
| Cytofix/Cytoperm Fixation/Permeabilization Solution |
BD |
Cat No. 554714 |
| Doxycycline hyclate |
Sigma-Aldrich |
Cat No. D9891 |
| Alt-R S.p. Cas9 Nuclease V3 |
IDT |
Cat No. 1081058 |
| Histopaque 1077 |
Millipore Sigma |
Cat No. 10771-500 |
| Critical Commercial Assays |
| Direct-zol RNA Microprep |
Zymo Research |
Cat No. R2060 |
| RNeasy RNA Isolation Kit |
Qiagen |
Cat No. 74106 |
| Applied Biosystems High-Capacity cDNA Reverse Transcription Kit |
Thermo Fisher Scientific |
Cat No. 4368814 |
| TaqMan Universal Master Mix II with UNG |
Thermo Fisher Scientific |
Cat No. 4440039 |
| Infusion HD |
Takara Bio |
Cat No. 638909 |
| CloneAmp HiFi PCR Premix |
Takara Bio |
Cat No. 639298 |
| MycoAlert PLUS Mycoplasma Detection Kit |
Lonza |
Cat No. LT07-703 |
| Invitrogen Taq polymerase |
Thermo Fisher |
Cat No. 10342020 |
| Experimental Models: Cell Lines |
| HEK293T |
ATCC |
ATCC CRL-3216 |
| HC-derived primary dermal fibroblasts |
ATCC |
Cat No. CRL2088 |
| HC-derived primary dermal fibroblasts |
Coriell institute |
Cat No. GM03440, GM08447 |
| DS-derived primary dermal fibroblasts |
ATCC |
Cat No. CCL54 |
| DS-derived primary dermal fibroblasts |
Coriell institute |
Cat No. AG08942, GM04616 |
| Oligonucleotides |
|
MX1 mRNA TaqMan FAM Hs200895608_m1 |
Thermo Fisher |
Cat No. 4331182 |
|
IFI27 mRNA TaqMan FAM Hs01086373_g1 |
Thermo Fisher |
Cat No. 4351370 |
|
IFIT1 mRNA TaqMan FAM Hs03027069_s1 |
Thermo Fisher |
Cat No. 4331182 |
|
USP18 mRNA TaqMan FAM Hs00276441_m1 |
Thermo Fisher |
Cat No. 4331182 |
|
RSAD2 mRNA TaqMan FAM Hs00369813_m1 |
Thermo Fisher |
Cat No. 4351370 |
|
IFNAR2 CRISPR gRNA ATTTCCGGTCCATCTTATCA |
IDT |
N/A |
|
USP18 CRISPR gRNA CATTACGAACACCTGAATCA |
IDT |
N/A |
| Recombinant DNA |
| pMET7-IFNAR2 |
Laboratory of Sandra Pellegrini |
N/A |
| IFNAR2_TETonBFP_TRE3G |
This paper |
N/A |
| Reverse Tetracycline-Controlled Transactivator (rtTA) |
Addgene |
Plasmid No. 66810 |
| pCAGGS-VSV-G |
This paper |
N/A |
| pCMV-Gag/Pol |
This paper |
N/A |
| Software and Algorithms |
| Cytobank |
Beckman Coulter |
N/A |
| FlowJo |
Becton Dickinson Company |
N/A |
| Fiji |
ImageJ |
N/A |
| Cell Profiler |
Broad Institute |
N/A |
| GraphPad Prism 9 |
GraphPad Software |
N/A |
