Skip to main content
. 2022 Oct 27;23(21):13018. doi: 10.3390/ijms232113018

Table 1.

Sequence variants in the selected 949 bp promoter region including the 159 bp 5′ UTR in BFMI, B6N, AKR, and SJL. The causal SNP rs29947545 responsible for the reduction in expression in the dual-luciferase assay is shown in bold.

Sequence Variant Number rs ID BFMI B6N AKR SJL
1 rs232831355 G A G G
2 rs247169908 G T G G
3 rs578752359 T C C C
4 rs47275624 C A C C
5 rs47931207 G A G G
6 rs46590687 T G T T
7 rs47190609 T G T T
8 rs48376078 T G T T
9 rs51982785 A G A A
10 rs225736719 A G A A
11 rs247385341 GCGAAGCTCCA GCGAAGCTCCAGCGAAGCTCCA GCGAAGCTCCAGCGAAGCTCCA GCGAAGCTCCAGCGAAGCTCCA
12 rs227723138 G T G G
13 rs51089963 C A C C
14 rs29947551 A G A A
15 rs29947548 C G C C
16 rs29947545 C T C C