Key Resource Table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit monoclonal anti-V5 | Cell Signaling Technology | Cat#13202S; RRID: AB_2687461 |
| Mouse monoclonal anti-FLAG | Sigma | Cat#F3165; RRID: AB_259529 |
| Rabbit monoclonal anti-FLAG | Cell Signaling Technology | Cat#14793S; RRID: AB_2572291 |
| Mouse monoclonal anti-beta actin | Invitrogen | Cat#BA3R; RRID: AB_10979409 |
| Strepavidin horseradish peroxidase conjugate | Invitrogen | Cat#S911 |
| Mouse monoclonal anti-fibrillarin | Abcam | Cat#ab4566; RRID: AB_304523 |
| Rabbit monoclonal anti-lamin B1 | Abcam | Cat#ab133741; RRID: AB_2616597 |
| Rabbit monoclonal anti-histone H3 | Cell Signaling Technology | Cat#4499S; RRID: AB_10544537 |
| Rabbit monoclonal anti-LAMA3 | Abcam | Cat#ab151715 |
| Rabbit polyclonal anti-PES1 | Bethyl Laboratories | Cat#A300-903A-2; RRID: AB_625300 |
| Rabbit polyclonal anti-BOP1 | Bethyl Laboratories | Cat#A302-148A-1; RRID: AB_1720319 |
| Rabbit polyclonal anti-WDR12 | Bethyl Laboratories | Cat#A302-650A; RRID: AB_10568823 |
| Rabbit polyclonal anti-puromycin | Kerafast | Cat#EQ0001; RRID: AB_2620162 |
| Anti-FLAG M2 affinity gel | Sigma | Cat#A2220; RRID: AB_10063035 |
| Goat anti-rabbit IgG horseradish peroxidase conjugate | Rockland | Cat#611-1302; RRID: AB_218567 |
| Goat anti-mouse IgG horseradish peroxidase conjugate | Rockland | Cat#610-1319-0500; RRID: AB_219659 |
| Goat anti-rabbit IgG Alexa FluorTM 568 | Invitrogen | Cat#A11011; RRID: AB_143157 |
| Goat anti-mouse IgG Alexa FluorTM 647 | Invitrogen | Cat#A21235; RRID: AB_2535804 |
| Strepavidin Alexa FluorTM 647 conjugate | Invitrogen | Cat#S21374; RRID: AB_2336066 |
| Bacterial and virus strains | ||
| One Shot Stbl3 Chemical Competent E. coli | Thermo Fisher Scientific | Cat#C737303 |
| Chemicals, peptides, and recombinant proteins | ||
| DPBS, no calcium, no magnesium | Gibco | Cat#14190250 |
| RPMI 1640 Medium | Gibco | Cat#1875-093 |
| DMEM, high glucose, pyruvate | Gibco | Cat#11995065 |
| Fetal Bovine Serum | Sigma Aldrich | Cat#F4135-500ML |
| Penicillin-Streptomycin (10,000 U/mL) | Gibco | Cat#15140122 |
| 2-Mercaptoethanol | Sigma Aldrich | Cat#M6250-10ML |
| PEI MAX | Polyscience | Cat#24765-1 |
| PEG8000 | Promega | Cat#V3011 |
| RIPA buffer | Boston BioProducts | Cat#BP-115 |
| Protease inhibitor coctail | Thermo Fisher Scientific | Cat#78437 |
| Pierce™ BCA Protein Assay Kit | Thermo Fisher Scientific | Cat#23227 |
| QuickExtract DNA Extraction Solution | Epicenter | Cat#QE09050 |
| QIAamp DNA Blood Mini Kit | Qiagen | Cat#51106 |
| Gibson Assembly® Master Mix | NEB | Cat#E2611 |
| Phusion Flash High-Fidelity PCR Master Mix | Thermo Fisher Scientific | Cat#F548L |
| QIAquick Gel Extraction Kit | Qiagen | Cat#28706 |
| TRIzol™ Reagent | Invitrogen | Cat#15596026 |
| RNeasy Plus mini isolation kit | Qiagen | Cat#74134 |
| 4–20% Mini-PROTEAN® TGX™ Precast Protein Gels, 10-well | BioRad | Cat#4561094 |
| Bovine Serum Albumin | Sigma Aldrich | Cat#A9418-100G |
| Pierce™ ECL Western Blotting Substrate | Thermo Fisher Scientific | Cat#32106 |
| EDTA | Sigma Aldrich | Cat#E8008-100ML |
| puromycin | Sigma Aldrich | Cat#P8833 |
| biotin | Sigma Aldrich | Cat#B4501 |
| Dynabeads™ M-280 Streptavidin | Thermo Fisher Scientific | Thermo Fisher |
| Formalin | Thermo Fisher Scientific | Cat#SF100-4 |
| DAPI | EMD Millipore | Cat#268298 |
| 3×FLAG peptide | Sigma Aldrich | Cat#F4799 |
| Lipofectamine 2000 | Thermo Fisher Scientific | Cat#11668019 |
| 5-ethynyluridine | Click Chemistry Tools | Cat#1261-10 |
| BMH-21 | Cayman Chemical Company | Cat#22282-5mg |
| Alexa FluorTM 488 Azide | Click Chemistry Tools | Cat#1275-1 |
| Critical commercial assays | ||
| Dual-Luciferase® Reporter Assay System | Promega | Cat#E1910 |
| iScript gDNA Clear cDNA Synthesis Kit | Bio-Rad | Cat#172-5035 |
| iTaq Universal SYBR Green Supermix | Bio-Rad | Cat#172-5121 |
| Deposited data | ||
| Raw and analyzed mRNA sequencing data | This paper | GEO: GSE205869 |
| Raw proteomic data | This paper | PRIDE: PXD033067 |
| Raw imaging and Western blotting data | This paper | Mendeley: https://doi:10.17632/yh8t333wwp.1 |
| Custom code | Khitun and Slavoff, 2019 | Zenodo: https://doi.org/10.5281/zenodo.5921116 |
| Experimental models: Cell lines | ||
| Human: HEK 293T | ATCC | Cat#CRL-3216 |
| Human: HEK 293FT | Thermo Fisher Scientific | Cat# R70007 |
| Human: HeLa | ATCC | Cat#CCL-2 |
| Human: A549 | Dr. Craig Crews (Yale University) | N/A |
| Cercopithecus aethiops: COS7 | ATCC | Cat#CRL-1651 |
| Experimental models: Organisms/strains | ||
| Mouse: C57BL/6J mice | The Jackson Laboratory | Cat#000664 |
| Oligonucleotides | ||
| Primer: alt-LAMA3 Forward: CTGGCTTTGACCTGAGCGGTGAGT | This paper | N/A |
| Primer: alt-LAMA3 Reverse: ACCAAATTCGTTTACAAGCCTCCT | This paper | N/A |
| Primer: LAMA3 Forward: CACCGGGATATTTCGGGAATC | This paper | N/A |
| Primer: LAMA3 Reverse: AGCTGTCGCAATCATCACATT | This paper | N/A |
| Primer: Primary pre-rRNA Forward: CTCCGTTATGGTAGCGCTGC | This paper | N/A |
| Primer: Primary pre-rRNA Reverse: GCGGAACCCTCGCTTCTC | This paper | N/A |
| Primer: 7SL-RNA Forward: ATCGGGTGTCCGCACTAAGTT | This paper | N/A |
| Primer: 7SL-RNA Reverse: CAGCACGGGAGTTTTGACCT | This paper | N/A |
| Recombinant DNA | ||
| pLJM1-V5-TurboID-fibrillarin | This paper | N/A |
| pLJM1-V5-TurboID-H2B | This paper | N/A |
| pLJM1-V5-TurboID-lamin B1 | This paper | N/A |
| pLJM1-V5-TurboID-3xNLS | This paper | N/A |
| pMD2.G | pMD2.G was a gift from Didier Trono | Addgene Plasmid #12259 |
| psPAX2 | psPAX2 was a gift from Didier Trono | Addgene Plasmid #12260 |
| pSpCas9(BB)-2A-GFP | pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang | Addgene Plasmid # 48138 |
| pXD017-V5-TurboID-fibrillarin | This paper | N/A |
| pXD017-V5-TurboID-H2B | This paper | N/A |
| pXD017-V5-TurboID-lamin B1 | This paper | N/A |
| pXD017-V5-TurboID-3xNLS | This paper | N/A |
| pAdDeltaF6 | pAdDeltaF6 was a gift from James M. Wilson | Addgene Plasmid # 112867 |
| Software and algorithms | ||
| ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ |
| Bowtie2 | Langmead and Salzberg, 2012 | http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| Samtools | Li et al., 2009 | http://samtools.sourceforge.net/ |
| GraphPad Prism (version 9.0) | GraphPad | https://www.graphpad.com/scientificsoftware/prism/ |
| Mascot | Matrix Science | https://www.matrixscience.com/ |
| MaxQuant | MaxQuant lab | https://www.maxquant.org/ |
| Perseus | MaxQuant lab | https://maxquant.net/perseus/ |
| Python (2.7.11) | Python Software Foundation, DE | https://www.python.org/downloads/ |
| Cutadapt (1.9.1) | Marcel Martin, 2010 | https://cutadapt.readthedocs.io/en/stable/ |
| STAR (2.7.1) | Alexander Dobin et al., 2013 | http://code.google.com/p/rna-star/ |