Figure 4.

PCR to detect ctxA in the stool samples of diarrhea patients. DNA was extracted from the stool samples of 23 patients who were diagnosed with cholera disease. PCR to amplify ctxA in these DNA samples was performed using the specific primers ctcagacgggatttgttaggcacg and tctatctctgtagcccctattacg⁶, and the products were analyzed by agarose gel electrophoresis. The sample numbers are the same as the numbers shown in the footnotes of Fig. 3. Numbers beginning with D in parentheses show the order of the content of DNA from V. cholerae among these samples. The samples indicated by blue circle are samples from the diarrheal stools of patients (patients 12 and 18), who are focused on in this study. S: the size marker for gel electrophoresis; N: the negative control in which DNA was not added to the reaction mixture; P: the positive control in which DNA prepared from V. cholerae O1 N16961²⁸ was added to the reaction mixture.