KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Ataxin-2 antibody | Novus | Cat# NBP1-90063; RRID:AB_11028587 |
| Tuj1 antibody | Biolegend | Cat# 802001; RRID:AB_2564645 |
| Actin antibody | EMD Millipore | Cat# MAB1501, RRID:AB_2223041 |
| RTN4/NoGo-Receptor antibody | Abcam | Cat# ab184556 |
| GAPDH antibody | Sigma Aldrich | Cat# G8795; RRID:AB_1078991 |
| Goat anti-Rabbit HRP antibody | Life Technologies | Cat# 31462; RRID:AB_228338 |
| Goat anti-mouse HRP antibody | Thermo Fisher Scientific | Cat# 62–6520; RRID:AB_2533947 |
| MAP2 antibody | Synaptic Systems | Cat# 188004; RRID:AB_2138181 |
| NeuN antibody | EMD Millipore | Cat# MAB377; RRID:AB_2298772 |
| Chemicals, peptides, and recombinant proteins | ||
| NEP1-40 peptide | Tocris | Cat# 1984 |
| Critical commercial assays | ||
| Nano-Glo HiBiT Lytic Detection System | Promega | Cat# N3050 |
| ONE-GLO Luciferase Assay System | Promega | Cat# E6120 |
| TaqMan gene-specific expression assay: human ATXN2 | Thermo Fisher Scientific | Hs00268077_m1 |
| TaqMan gene-specific expression assay: human ACTB | Thermo Fisher Scientific | Hs01060665_g1 |
| TaqMan gene-specific expression assay: human RTN4R | Thermo Fisher Scientific | Hs00368533_m1 |
| TaqMan gene-specific expression assay: mouse ATXN2 | Thermo Fisher Scientific | Mm00485932_m1 |
| TaqMan gene-specific expression assay: mouse GAPDH | Thermo Fisher Scientific | Mm99999915_g1 |
| TaqMan gene-specific expression assay: mouse RTN4R | Thermo Fisher Scientific | Mm00452228_m1 |
| Human ATXN2 siRNA | Horizon Discovery | Cat# L-011772-00 |
| Non-targeting siRNA | Horizon Discovery | Cat# D-001810-10 |
| Human RTN4R siRNA | Horizon Discovery | Cat# L-008075-00 |
| Oligonucleotides | ||
| Target-specific sgRNA sequence | IDT | AGCCTTACAACTGCTGTTGG |
| Forward Primer for ATXN2 exon 25 amplification and sequencing | IDT | GCAATACTGGTGCTTGGCTAATATTTGGGG |
| Reverse Primer for ATXN2 exon 25 amplification and sequencing | IDT | CACTCTTGTTACTTCTTTTGCTAGCTGATGTG |
| Deposited data | ||
| iNeuron RNA sequencing data | GEO | GEO: GSE200530 |
| Experimental models: Cell lines | ||
| HEK293T Cells | ATCC | Cat# CRL-321; RRID:CVCL_0063 |
| SH-SY5Y | ATCC | Cat# CRL-226; RRID:CVCL_0019 |
| Experimental models: Organisms/strains | ||
| Time pregnant C57BL/6 | Charles River Labs | Cat# C57BL/6NCr; RRID:MGI:2159769 |
| Rtn4r KO mouse line | Provided by Dr. Stephen Strittmatter | N/A |
| Recombinant DNA | ||
| Mission® shRNA, mouse RTN4R | Sigma Aldrich | TRCN0000436683 |
| Mission® shRNA, human RTN4R | Sigma Aldrich | TRCN0000061558 |