Key resources table.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-polyGly rabbit polyclonal | (Rogowski et al.104; Xia et al.139) | N/A |
| Anti-α-tubulin DM1α mouse monoclonal | Sigma | Cat# T9026-.2ML |
| LICOR IRDye 680LT Goat anti-Mouse IgG (H + L) | LI-COR BioScience | Cat# 926-68020 |
| LICOR IRDye 800CW Goat anti-Rabbit IgG (H + L) | LI-COR BioScience | Cat# 926-32211 |
| Bacterial and virus strains | ||
| E.coli BL21 (DE3) | NEB | Cat# C2527H |
| E. coli Arctic Express (DE3) | Agilent | Cat# 230192 |
| E. coli Rosetta2(DE3)pLysS | Novagen | Cat# 71401 |
| Chemicals, peptides, and recombinant proteins | ||
| GMPCPP | Jena Bioscience | Cat# NU-405L |
| Catalase from bovine liver | Sigma Aldrich | Cat#C40 |
| Glucose Oxidase from Aspergillus niger | Sigma Aldrich | Cat#G7141 |
| Pluronic F-127 | Life Technologies | Cat#P6866 |
| Casein | Sigma Aldrich | Cat#C5890 |
| Neutravidin | Life Technologies | Cat#31000 |
| C.elegans Katanin MEI-1/MEI-2 | This study (Zehr et al.127) | N/A |
| Human Unmodified Tubulin from tSA201 Cells | This study (Vemu et al.71) | N/A |
| H.sapiens α1A-Tubulin (NP_001257328) H.sapiens βIII-Tubulin (NM_006077) | (Chen et al.20, Vemu et al.133) | N/A |
| H.sapiens α1A-Tubulin detyrosinated H.sapiens βIII-Tubulin (NM_006077) | (Chen et al.20) | N/A |
| H.sapiens α1A-Tubulin tailless (aa 1-439) H.sapiens βIII-Tubulin (NM_006077) | (Chen et al.20) | N/A |
| Porcine Brain Tubulin | Cytoskeleton, Inc. | Cat# T238P |
| HiLyte647-Labeled Porcine Tubulin | Cytoskeleton, Inc. | Cat# TL670M |
| HiLyte488-Labeled Porcine Tubulin | Cytoskeleton, Inc. | Cat# TL488M |
| Biotin-Labeled Porcine Tubulin | Cytoskeleton, Inc. | Cat# T333P-B |
| Atto488-Labeled C.elegans Katanin | This study (Zehr et al.53) | N/A |
| Atto488-Labeled C. elegans Katanin MEI-1 (aa 1-150)/MEI-2 (aa 68-280) | This study | N/A |
| M. musculus TTLL6 aa 51-502 | (Mahalingan et al.66) | NP_766387.2 |
| X. tropicalis TTLL7 aa1-520 | (Valenstein et al.60) | NP_001136132.1 |
| X. tropicalis TTLL3 aa 6-569 | (Garnham et al.78) | N/A |
| X. tropicalis TTLL10 aa 105-570 | This study | N/A |
| Human VASH1/SVBP | T.R. Brummelkamp (Netherlands Cancer Institute) (Nieuwenhuis et al. 84) | N/A |
| D. rerio TAT1 aa 1-196 | Szyk et al.96, Vemu et al.71 | N/A |
| Peptide: VDSVEGEGEEEGEEY | Bio-Synthesis Inc/ (Zehr et al.53) | N/A |
| Peptide: VDSVEGEGEEEGEE | Bio-Synthesis Inc | N/A |
| Critical commercial assays | ||
| EnzCheck™ Phosphate Assay Kit | Thermo Fisher | Cat# E6646 |
| Deposited data | ||
| Katanin Hexamer In The Spiral Conformation Bound To Substrate | (Zehr et al.53) | PDBID: 6UGD |
| Experimental models: Cell lines | ||
| Human: tsA201 Cells Derived From HEK293 | Millipore Sigma | Cat# 96121229-1VL |
| Sf9 insect cells | Gibco | Cat#12659-017 |
| Oligonucleotides | ||
| Primers for C.elegans Katanin Mei-1 aa 1–150 in pCDF-Duet: introducing the stop codon after aa 150: GGCTGATGTGAAACCGGCGAATtaaACCCAGGGCATT, AATGCCCTGGGTTTAATTCGCCGGTTTCACATCAGCC | Eurofins Genomics LLC | N/A |
| Primers for C.elegans Katanin Mei-1 aa 1–150 in pCDF-Duet: insertion of 3C protease site and StrepTagII: GCTGATGTGAAACCGGCGAATctggaagttctgttccaggggccctcagcgtggagccacccgcagttcgagaaataaACCCAGGGCATTCTGCC, GGCAGAATGCCCTGGGTttatttctcgaactgcgggtggctccacgctgagggcccctggaacagaacttccagATTCGCCGGTTTCACATCAGC | Eurofins Genomics LLC | N/A |
| Primers for C.elegans Katanin Mei-2 aa 68–280 with sortase tag in pMAL C5X: cloning of Mei-2 aa 68–280 to pMAL C5X: GAATTCcatatgGAAAACCTATATTTCCAATCAAGACGTCCATTGCATTCCGAG, GTCGACggatccTTACTTATGGCTGGAAACTTTTTTCAATCGC | Eurofins Genomics LLC | N/A |
| Primers for C.elegans Katanin Mei-2 aa 68–280 with sortase tag in pMAL C5X: insertion of sortase tag: gaaaaaagtttccagccataagGGCGGTGGCGGTTCTCTGCCGGAAACCGGCGGTtaaAAGCTTgcggccgc, gcggccgcAAGCTTttaACCGCCGGTTTCCGGCAGAGAACCGCCACCGCCcttatggctggaaacttttttc | Eurofins Genomics LLC | N/A |
| Recombinant DNA | ||
| Human VASH1 in pFastBac™-based vector | T.R. Brummelkamp (Netherlands Cancer Institute) (Nieuwenhuis et al.84) |
N/A |
| Human SVBP in pFastBac™-based vector | T.R. Brummelkamp (Netherlands Cancer Institute) (Nieuwenhuis et al. 84) |
N/A |
| H.sapiens α1A-Tubulin and βIII-Tubulin in pFastBac™-Dual, Codon Optimized for Baculovirus Expression | (Vemu et al.71) | N/A |
| C.elegans Katanin Mei-1 in pCDF-Duet | Francis McNally (UC Davis) (McNally et al.134) |
NP_492257.1 |
| C.elegans Katanin Mei-2 in pMAL-CRI | Francis McNally (UC Davis) (McNally et al.134) |
NP_491894.1 |
| C.elegans Katanin Mei-2 with sortase tag in pMAL-CRI | This study (Zehr et al.53) | NP_491894.1 |
| C.elegans Katanin Mei-1 aa 1–150 in pCDF-Duet | This study | NP_492257.1 |
| C.elegans Katanin Mei-2 aa 68–280 with sortase tag in pMAL C5X | This study | NP_491894.1 |
| Software and algorithms | ||
| ImageJ Fiji | (Schindelin et al.141) | https://fiji.sc |
| Prism | Graphpad | https://www.graphpad.com/scientific-software/prism/ |
| Software for modeling: Coot | (Emsley et al.143) | https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ |
| Software for modeling: Phenix | (Moriarty et al.142) | https://phenix-online.org/download/ |
| Software for protein structure image rendering: ChimeraX, | (Goddard et al.147) | https://www.cgl.ucsf.edu/chimerax/ |
| Software for protein structure image rendering: UCSF Chimera | (Pettersen et al.146) | https://www.cgl.ucsf.edu/chimera/ |
| MassHunter | Agilent | https://www.agilent.com/en/product/software-informatics/mass-spectrometry-software |
| PyMOL | (Schrodinger148) | https://pymol.org/2/#page-top |
| Biorender (part of Fig. 7K and graphical abstract) | Biorender | https://biorender.com |