Table 2.

List of the primers used for the amplification of the complete genome of plumeria mosaic virus (PluMV) from Plumeria rubra F. acutifolia, and for the detection of PluMV and frangipani mosaic virus (FrMV).

Primera name	Primer sequence (5′ to 3′)	Primer location (nt)	Annealing temperature (°C)	Amplicon length (~Kb)	Remarks
For the amplification of complete genome of PluMV
BM116R	tgacaagtcgacttgtcatatttagaaacatcaagctc	4,348–4,373	58	1.3	Part of rep
BM115Fd b	gtawktttwmawywwttwmyaaywacaacaa	1–31
BM204R	caatgacttggtcaaagtcctca	3,231–3,253	58	3.1	5′ UTR and part of rep gene
BM239F	ggatcc ccaaagggtaatatttaccaacaatt	1–26	58	1.9	5′ UTR and part of rep gene
BM222R	tcgcagccaatgcactctccc	1967–1987
BM348F	gctagcaaaacatggcttttgac	2,455–2,477	58	3.0	part of replicase and movement protein genes
BM240R	gtcgac ctaaatatcttcattatctccacttt	5,793–5,818
BM649F	aattacttcccaagtcgatgactag	5,121–5,145	58	1.3	part of movement protein and coat protein genes
BM140R	gcgtaa gtcgac ttacgcggtagtagtacccg	6,382–6,404
BM205F	gatgcttcggggttggtatggg	6,321–6,342	58	0.4	part of coat protein and 3′ UTR
BM119R	agcccagtcgactgggccgctaccgggggtta	6,668–6,686
Primers used for 5′ RACE (5′-Full RACE core set)
BM667R	(p)-aacaaaaagtatcaaccaaag	1,075	42	1.1	cDNA synthesis
BM520F	ggcaggcttacatcgtttttcga	579–601	62	1.0	Outer RACE
BM530R	actctggcaatatctctaatgtcc	478–500
BM244F	aagatggtagttacgccgtcg	704–724	62	0.8	Inner RACE
BM452R	ttgcaacaatgaacatacgagcgt	444–467
Primers used for 3′ RACE
BM210(Adaptor)	gcgagcacagaattaatacgactcactataggttttttttttttvn	6,688	42	Full length	cDNA synthesis
BM649F	aattacttcccaagtcgatgactag	5,121–5,145	58	1.6	Outer RACE
Outer RACE primer	gcgagcacagaattaatacgact	Outer part of adaptor
BM205F	gatgcttcggggttggtatggg	6,289–6,310	58	0.4	Inner RACE
Inner RACE primer	cgcggatccgaattaatacgactcactatagg	Inner part of adaptor
Primers used for the specific detection of plumeria mosaic virus and frangipani mosaic virus
BM348F	gctacg aaaacatggcttttgac	2,455–2,477	58	0.8 Kb	PluMV
BM204R	caatgacttggtcaaagtcctca	3,231–3,253
BM520F	ggcaggcttacatcgtttttcga	579–601	58	1.2 Kb
BM521R	aaacaagcgcctacgttaacctt	1744–1766
BM200R	aattcctgttttgaacttagattcg	4,282–4,306	58	2.0 Kb	FrMV
BM523Fc	gacggcaaccttgaacaatttgc	2,333–2,355
BM607R	attgtagttgcatcaaaattattaagta	3,637–3,664	58	1.3 Kb

^aPosition of the primers on the viral genome are shown in Figure 1,

^bBM115_dF is a common degenerate primer with BM116R and BM204R.

^cBM523F is common primer with BM200R and BM607R,

F: Forward, R: Reverse, underline: Restriction site.