KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Chemicals, peptides, and recombinant proteins | ||
| Halocarbon oil 27 | Sigma-Aldrich | Cat#H8773 |
| Halocarbon oil 700 | Sigma-Aldrich | Cat#H8898 |
| XL413 hydrochloride | Sigma-Aldrich | Cat#SML1401; CAS#1169562-71-3 |
| Aphidicolin from Nigrospora sphaerica | Sigma-Aldrich | Cat#A0781; CAS#38966-21-1 |
| ECFP-Geminin | (McCleland et al., 2009) | N/A |
| 5-EUTP | Abcam | Cat#ab146744 |
| Cy5-dUTP | Sigma-Aldrich | Cat#GEPA55022 |
| Fluoromount aqueous mounting medium | Sigma-Aldrich | Cat#F4680 |
| 37% formaldehyde | Thermo Fisher Scientific | Cat#F79-500 |
| Deposited data | ||
| Raw imaging data | This paper; Zenodo | Zenodo: https://doi.org/10.5281/zenodo.7102432 |
| Custom codes | This paper; Zenodo | Zenodo: https://doi.org/10.5281/zenodo.7102452 |
| Experimental models: Organisms/strains | ||
| D. melanogaster: Wild type. Canton S w[1118] | This paper | N/A |
| D. melanogaster: w; EGFP-Rpb3 | This paper | N/A |
| D. melanogaster: w, mCherry-Rpb1 | This paper | N/A |
| D. melanogaster: w, mCherry-Rpb1; EGFP-Rpb3 | This paper | N/A |
| D. melanogaster: w; ; His2Av-mRFP | Bloomington Drosophila Stock Center | BDSC:23650 |
| D. melanogaster: w; EGFP-Rpb3; His2Av-mRFP | This paper | N/A |
| D. melanogaster: w; ; mCherry-PCNA | (Seller and O’Farrell, 2018) | N/A |
| D. melanogaster: w; EGFP-Rpb3; mCherry-PCNA | This paper | N/A |
| D. melanogaster: yw, Mxc-mScarlet | (Kemp et al., 2021) | N/A |
| D. melanogaster: yw, Mxc-mScarlet; EGFP-Rpb3 | This paper | N/A |
| D. melanogaster: nos-MCP-mCherry (III) | Laboratory of Hernan G. Garcia | N/A |
| D. melanogaster: w; EGFP-Rpb3; nos-MCP-mCherry | This paper | N/A |
| D. melanogaster: nos-MCP-EGFP (II) | Bloomington Drosophila Stock Center | BDSC:63821 |
| D. melanogaster: w, mCherry-Rpb1; nos-MCP-EGFP | This paper | N/A |
| D. melanogaster: y[1] w[*]; | Bloomington Drosophila | BDSC:60338 |
| P{hbP2-MS2-lacZ}JB38F | Stock Center | |
| D. melanogaster: w[1118]; PBac{y[+mDint2] | Bloomington Drosophila | BDSC:51324 |
| GFP[E.3xP3]=vas-Cas9}VK00027 | Stock Center | |
| Oligonucleotides | ||
| Forward strand oligo for Rpb1 sgRNA: CTTCGTCCTGGTCGTCAGCGATAC | This paper | N/A |
| Reverse strand oligo for Rpb1 sgRNA: AAACGTATCGCTGACGACCAGGAC | This paper | N/A |
| Forward strand oligo for Rpb3 sgRNA: CTTCGCGGACGGCTGGTTGGCGTA | This paper | N/A |
| Reverse strand oligo for Rpb3 sgRNA: AAACTACGCCAACCAGCCGTCCGC | This paper | N/A |
| Forward primer for mCherry-Rpb1 upstream homology arm: CACAT CCTTGGCTCCGGATAGCTTCCAG | This paper | N/A |
| Reverse primer for mCherry-Rpb1 downstream homology arm: TCTGAT GCTTCCACTCGGCGGTGAGATC | This paper | N/A |
| Forward primer for EGFP-Rpb3 upstream homology arm: GTTTC AGAAGAGTGGGACATTTGGC | This paper | N/A |
| Reverse primer for EGFP-Rpb3 downstream homology arm: CAAAG GATCTACGAGACCGCACTGGA | This paper | N/A |
| Recombinant DNA | ||
| pU6-BbsI-chiRNA | (Gratz et al., 2013) | Addgene plasmid #45946 |
| pDsRed-attP | Gift from Melissa Harrison & Kate O’Connor-Giles & Jill Wildonger | Addgene plasmid #51019 |
| pU6-Rpb1-Ntag | This paper | N/A |
| pU6-Rpb3-Ntag | This paper | N/A |
| pHD-mCherry-Rpb1 | This paper | N/A |
| pHD-EGFP-Rpb3 | This paper | N/A |
| Software and algorithms | ||
| Volocity 6.3 | Quorum | |
| FIJI (ImageJ) | (Schindelin et al., 2012) | |
| Python 3 | Python Software Foundation | https://www.python.org |
| R v3.2.1 | The R Foundation | https://www.r-project.org/ |