KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit polyclonal anti-phospho-p70 S6K1(Thr389) | Cell Signaling Technology | Cat#9205 |
| Rabbit polyclonal anti-p70 S6K1 | Cell Signaling Technology | Cat#9202 |
| Rabbit polyclonal anti-Tuberin/TSC2 | Cell Signaling Technology | Cat#3612 |
| Rabbit monoclonal anti-Tuberin/TSC2 | Cell Signaling Technology | Cat#4308 |
| Rabbit monoclonal anti-Hamartin/TSC1 | Cell Signaling Technology | Cat#6935 |
| Rabbit polyclonal anti-β-tubulin | Cell Signaling Technology | Cat#2146 |
| Mouse monoclonal anti-Rheb | Abnova | Cat#H00006009-M01 |
| Mouse monoclonal anti-p84 | GeneTex | Cat#GTX70220 |
| Goat anti-Rabbit HRP 2nd antibody | Pierce | Cat#PI31460 |
| Goat anti-Mouse HRP 2nd antibody | Pierce | Cat#PI31430 |
| Goat anti-Rabbit Alexa 488 2nd antibody | Life Technologies | Cat#A11034 |
| Goat anti-Mouse Alexa 488 2nd antibody | Life Technologies | Cat#A11001 |
| Bacterial and virus strains | ||
| pLKO mouse shRNA 1 raptor | Thoreen et al., 2009 | Addgene #21339 |
| pLenti CMVTRE3G Puro DEST (w811–1) (gateway) | N/A | Addgene #6141 (discontinued) |
| pLenti CMV rtTA3G Blast | N/A | Addgene #6136 (discontinued) |
| pLenti-TetOn-mCherry-Rheb | This paper | N/A |
| pLenti-TetOn-Lyso-mCherry-Rheb-C181S | This paper | N/A |
| pLenti-TetOn-Lyso-mCherry-Rheb-𝛥5A | This paper | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| PDGF | Sigma | Cat#P3201 |
| Rapamycin | LC Laboratories | Cat#R-5000 |
| FTI-277 | ApexBio | Cat#B5842 |
| DMSO | Sigma | Cat#D2650 |
| NP-40 | Millipore Sigma | Cat#492016 |
| Paraformaldehyde | Electron Microscopy Sciences | Cat#15710S |
| Doxycycline | Clontech | Cat#631311 |
| Critical commercial assays | ||
| LysoTracker Green DND-26 | Invitrogen | Cat#L7526 |
| Experimental models: Cell lines | ||
| NIH3T3 cells | ATCC | Cat#CRL-1658 |
| Cal27 | Gift from Silvio Gutkind Lab, UC San Diego | N/A |
| HeLa | ATCC | Cat#CCL-2 |
| Cos7 | ATCC | Cat#CRL-1651 |
| 3T3L1 | Gift from Alan Saltiel Lab, UC San Diego | N/A |
| PLC/PRF/5 | Gift from Gen-Sheng Feng Lab, UC San Diego | N/A |
| HEK293T | ATCC | Cat#CRL-3216 |
| Oligonucleotides | ||
| shRNA targeting sequence: mouse Rheb: CAGACATACTCCATAGATATT |
The RNAi Consortium | TRCN0000075605 |
| shRNA targeting sequence: mouse TSC2: TCGCAAGACTCCGCCACATTA |
The RNAi Consortium | TRCN0000306245 |
| Nonsense mutations in reconstituted Rheb: ACtTAtTCaATcGAc |
This paper | N/A |
| Recombinant DNA | ||
| pcDNA3-TORCAR | Zhou et al., 2015 | Addgene #64927 |
| pcDNA3-TORCAR-NLS | Zhou et al., 2015 | Addgene #64931 |
| pcDNA3-TORCAR-NES | Zhou et al., 2020 | Addgene #175015 |
| pcDNA3-Flag-TSC2 | Manning et al., 2002 | Addgene #14129 |
| pcDNA3-Flag-TSC2-AA | Manning et al., 2002 | Addgene #14131 |
| pcDNA3-mCherry-TSC2 | This paper | N/A |
| pcDNA3-mCherry-TSC2-AA | This paper | N/A |
| pcDNA3-mCherry-TSC2-AA-3Q | This paper | N/A |
| pcDNA3-mCherry-TSC2-NLS | This paper | N/A |
| pcDNA3-mCherry-TSC2-AA-NLS | This paper | N/A |
| pcDNA3-mCherry-TSC2-AA-3Q-NLS | This paper | N/A |
| myc-Rheb | Provided by Kun-Liang Guan Lab, UC San Diego | N/A |
| pcDNA3-mCherry-Rheb | This paper | N/A |
| pcDNA3-mCherry-Rheb-C181S | This paper | N/A |
| pcDNA3-mCherry-Rheb-𝛥5A | This paper | N/A |
| pcDNA3-Lyso-mCh-Rheb-C181S | This paper | N/A |
| Software and algorithms | ||
| MATscope imaging suite | Open source | DOI: 10.5281/zenodo.5908008 |
| Prism 9 | GraphPad | https://www.graphpad.com |