| TGF-β | Sequence of forward | 5’-AGCCGTGGAGGGGAAATTG-3’ |
| Sequence of reverse | 5’-CGGTAGTGAACCCGTTGATG- 3’ | |
| αSMA | Sequence of Forward | 5’-TATCCCCGGGACTAAGACGG- 3’, |
| Sequence of reverse | 5’-CACCATCACCCCCTGATGTC-3’ | |
| COL 1α | Sequence of Forward | 5’- TGAAGGACACAGAGGTTCAG- 3’ |
| Sequence of reverse | 5’- GTAGCACATCATTTCCACGA- 3’ | |
| GAPDH | Sequence of Forward | 5’- GTCTCCTCTGACTTCAACAGCG − 3’ |
| Sequence of reverse | 5’- ACCACCCTGTTGCTGTAGCCAA − 3’ |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.