Skip to main content
NCBI home page
Veterinary Medicine and Science logoLink to Veterinary Medicine and Science
. 2022 Aug 30;8(6):2422–2433. doi: 10.1002/vms3.908

Regenerative and anti‐inflammatory effect of a novel bentonite complex on burn wounds

Ju Young Lee 1, Han Na Suh 1, Kwan Young Choi 3, Chang Woo Song 1,2, Jeong Ho Hwang 1,2,✉
PMCID: PMC9677418  PMID: 36040758

Abstract

Background

Bentonite, a montmorillonite clay, has been used as a classical remedy strategy for a long time. Recently, bentonite has been used as a raw material in cosmetic products because of its antibacterial and antioxidant properties. However, the therapeutic effect of bentonite on burn injuries has not yet been identified.

Objectives

The aim of this study was to explore the therapeutic effect of a novel bentonite complex, which was developed for medical use, on burn wounds and the anti‐inflammatory function of bentonite clay in the complex in vitro.

Methods

A novel bentonite complex and bentonite clay were prepared for each in vivo and in vitro assay (C&L Biotech, Seoul, Korea). Burn wounds were induced on the dorsal skin of two Yucatan minipigs, and effects of tissue regeneration and anti‐inflammation were assessed by histological and gene expression analysis.

Results

The bentonite complex improved skin regeneration in burn wounds by inducing collagen synthesis, cell proliferation and angiogenesis in vivo. Furthermore, expression of inflammatory cytokines was significantly inhibited by treatment of the bentonite complex. In vitro study for identification of anti‐inflammatory effect showed that bentonite clay significantly regulated COX‐2 signalling in both HacaT keratinocytes and 3D4/2 macrophage cell lines.

Conclusions

This study identified the therapeutic effect of a novel bentonite complex in burn wounds by inducing skin regeneration and bentonite‐mediated anti‐inflammatory responses.

Keywords: anti‐inflammation, bentonite, burn wound, minipig

Bentonite has been used as a material for a natural and classical remedy. However, the therapeutic effect of bentonite on skin injuries has not been identified yet. This study identified the therapeutic effect of a novel bentonite complex in burn wounds by inducing skin regeneration and anti‐inflammatory responses.

graphic file with name VMS3-8-2422-g003.jpg

1. INTRODUCTION

A burn is one of the most severe injuries caused by contact with a hot object, fire and even chemical agents (Alden et al., 2006; Evers et al., 2010). Burn wounds are classified into three degrees based on wound depth and total body surface area (TBSA) (Tiwari, 2012). Patients with high degree burns (>40% of TBSA) are vulnerable to pathogenic infection through a broken epidermal layer (Singer & Boyce, 2017). Burn wounds recover through a complex process, which is classified into four phases in the order of cutaneous haemostasis, regulation of inflammation, cell proliferation and tissue remodelling (Cañedo‐Dorantes & Cañedo‐Ayala, 2019; Eming et al., 2007; Rodrigues et al., 2019). The management and treatment of burn wounds has been accomplished by facilitating the progression of the recovery phases. Thus, researchers and medical companies are struggling to find novel materials that promote regeneration and anti‐inflammation (Cancio, 2021; Momcilović, 2002).

Bentonites, which originate from altered volcanic ash, have been used as major components in cosmetic and medical products (Babahoum & Hamou, 2021; Park et al., 2016). Formerly, bentonite has been considered a therapeutic material and even applied to wounds in cases of emergencies (Williams & Haydel, 2010). Recently, the biological functions of bentonites have been reported in various studies. Due to their physical characteristics, bentonites effectively remove toxins and protect against pathogenic infections caused by skin injury (Cervini et al., 2016). In addition, some studies have reported that bentonites improve cell migration, expansion, spreading and differentiation (Nones et al., 2015). Nevertheless, the therapeutic effects of bentonite on burn wounds have not yet been identified.

Here, we explored the therapeutic effects of a novel bentonite complex developed for medical use (C&L Biotech, Seoul, Korea) in a minipig burn wound model (Alex et al., 2020; Seaton et al., 2015; Summerfield et al., 2015). The therapeutic effect was investigated in terms of tissue regeneration and anti‐inflammation using gene expression and histological analysis (Bainbridge, 2013; Gantwerker & Hom, 2011). Furthermore, the anti‐inflammatory effect was explored in HacaT keratinocytes and 3D4/2 macrophage cell lines by analysing the inhibition of cyclooxygenase 2(COX‐2) / prostaglandin E2(PGE2) signalling (Albanesi et al., 2018; Bogaty et al., 2004; Colombo et al., 2017).

2. MATERIALS AND METHODS

2.1. Materials

Sterilised bentonite complex was prepared for in vivo assay (C&L Biotech). The ingredients of the bentonite complex are listed in Table 1. The bentonite complex was prepared at two concentrations (T1, 1 mg/ml; T2, 6 mg/ml) to evaluate dose dependency. Silver sulfadiazine 1% cream (Dongwha Pharm Co. Ltd, Seoul, South Korea) and saline solution were used for each positive control (PC) and negative control (NC).

TABLE 1.

Components of bentonite complex

Name Use EWG green grade 1
Bentonite clay Anti‐inflammation 2
Purified water Solvent 1
Glycerine Moisturizer 2
Mineral oil Skincare product 2
Sparassis crispa extract Moisturizer 1
Cetearyl alcohol Moisturizer 1
Shea butter Moisturizer 1
Cetyl ethylhexanoate Skin conditioning agent 1
Theobroma cacao seed butter Moisturizer 1
Hydrogenated polyisobutene Emollient 1
Coconut oil Skin conditioning agent 1
Cyclopentasiloxane Skin conditioning agent 3
Beeswax Skin care agent, detergent 1
Setearyl alcohol Moisturizer 1
1,2‐hexanediol Antioxidant 1
Olea europaea olive fruit oil Water evaporation blocking agent 1
Cetearyl glucoside Emulsifier 1
Dimethicone Sebum controlling agent 1
Glyceryle steate Skin conditioning agent 1
Cyclohexasiloxane Skin conditioning agent 2
Dimethicone Skin protecting agent 3
Dysodium edta Antioxidant 1
Open in a new tab
1

EWG (Environmental Working Group) green grade: EWG green grade means scoring products within the range of 1–10 according to the standards set from the EWG's study, with 1 representing the best score and 10 representing the worst.

For in vitro assay, bentonite clay (C&L Biotech) was autoclaved at 121°C for 1 h. The specific elements of the bentonite clay in the mixture were precisely measured using a inductively coupled plasma optical emission spectroscopy (Agilent 7700S, Agilent Technologies, St. Clara, CA, USA) in Table S1. Sterilised bentonite clay was suspended in 1 ml of UV‐irradiated phosphate buffered saline, diluted 10‐fold (100, 10 and 1 µg/ml) and incubated for 1 h at room temperature. The solution was centrifuged at 13,000 × g for 2 h to elute the soluble fraction to avoid physical damage to the cell lines. The supernatant was carefully collected and passed through a 0.22 µm micropore filter to remove any insoluble debris.

2.2. Animals

Male and female Yucatan minipigs (Sus scrofa domesticus; Optipharm, Cheongju Korea), aged 7–8 months old and weighing 9.5–12.5 kg, were subjected to surgery to create burn wounds. They were bred in individual cages under specific pathogen‐free (SPF) and controlled conditions (40%–60% humidity; 12 h/12 h light/dark cycle). Water was provided ad libitum, and food (Purina, St. Louis, USA) was provided daily at 2% of the body weight. Clinical status was monitored every morning, and checkpoints were increased to twice a day after surgery. A designated photographer recorded macroscopic observations by taking pictures of each wound on days 2, 10 and 21 (necropsy).

Burn inducement and post‐management were performed in the same manner as previous studies (Branski et al., 2008; Singer et al., 2011). Minipigs were anaesthetised by intramuscular injection of a mixture of ketamine (20 mg/kg) and xylazine (2 mg/kg). Anaesthesia was maintained with 0.5%–5% isoflurane. The burn wound was induced with a soldering iron with a square‐shaped tip at 180°C, held against the skin for 5 s. Each wound was 3 × 3 cm2, spaced at a 5 cm interval and had a depth of approximately 3 mm. The dorsal region of the minipigs was shaved with an electric clipper and cleaned with an alcohol swab to avoid infection. Full‐thickness burns were induced on the dorsal region of minipigs, producing a total of eight wounds induced on each side of the spine line for NC, PC, T1 and T2. Post‐surgical pain was managed with a peroral injection of acetaminophen (20 mg/kg). This study was approved by the Institutional Animal Care and Use Committee (approval number: KIT 1910‐0348).

2.3. In vitro assay

The porcine lung macrophage cell line 3D4/2 (ATCC CRL‐2845) and the human keratinocyte cell line HacaT (ATCC PCS‐200‐011) were used for the in vitro assays. The cells were grown at 37°C and 5% CO2 in culture media containing 10% foetal bovine serum (Gibco, Waltham, MA, USA) and 1% penicillin‐streptomycin (10,000 unit/ml; Gibco). A total of 20 ng of lipopolysaccharide (LPS, Sigma‐Aldrich, St. Louis, MO, USA) were added over a period of 6 h to induce immune cell stimulation. The bentonite clay was then mixed with the culture media (1:1) and treated with HacaT and 3D4/2.

2.4. Quantitative real‐time PCR

Total RNA was isolated manually using the phenol‐chloroform method. Reverse transcription reactions were performed using the QuantiNova Reverse Transcription Kit (Qiagen, Hilden, Germany). Quantitative real‐time PCR (qRT‐PCR) was performed in a 25 µl reaction mixture that included 2× Power SYBR Green PCR Master Mix (Applied Biosystems, Waltham, MA, USA), each primer at a concentration of 0.5 µM and QuantStudio 5 Real‐Time PCR System (Applied Biosystems). The following amplification parameters were used in the qRT‐PCR: an initial denaturation step at 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 15 s, annealing and elongation at 60°C for 1 min, without the final elongation step. Primer sequences used for qRT‐PCR are listed in Table 2. GAPDH was used as an endogenous control. The 2−ΔΔCt method was used for relative quantification of target genes.

TABLE 2.

Primers used for quantitative real‐time PCR

Species Gene symbol Primer sequences (from 5’ to 3’) Length (bp) Gene Bank ID
Porcine COX‐2 F: TTCAACCAGCAATTCCAATACCA 87 NM_214321.1
R: GAAGGCGTCAGGCAGAAG
PTGES F: AGAGCATGAAAACCATCACTCC 248 NM_001038631.1
R:CTCAAGGACATTCTGTCAGGTTC
CCL2 F: CTCCCACACCGAAGCTTGAA 120 NM_214214.1
R: TAATTGCATCTGGCTGGGCA
CXCL2 F: ATCCAGGACCTGAAGGTGA 116 NM_001001861.2
R: TTCTTCACCATGGGGGCT
TGFβ F: AGGGCTACCATGCCAATTTCT 101 NM_214015.2
R: CGGGTTGTGCTGGTTGTACA
TNFα F: ATGAGCACTGAGAGCATGATCCG 163 NM_214022.1
R: CCTCGAAGTGCAGTAGGCAGA
IL‐1β F: GAGCATCAGGCAGATGGTGT 134 NM_214055.1
R: CAAGGATGATGGGCTCTTCTTC
IL‐6 F: GCTGCTTCTGGTGATGGCTACTGCC 318 NM_001252429.1
R: TGAAACTCCACAAGACCGGTGGTGA
GAPDH F: ACAGACAGCCGTGTGTTCC 62 NM_001206359.1
R: ACCTTCACCATCGTGTCTCA
Human COX‐2 F: GAATGGGGTGATGAGCATGT 99 NM_000963.4
R: GCCACTCAAGTGTTGCACAT
IL‐1β F: GTGGCAATGAGGATGACTTGTTC 103 NM_000576.3
R: TAGTGGTGGTCGGAGATTCGTA
PTGES F: CTGCTGGTCATCAAGATGTACG 223 NM_004878
R: GGTTAGGACCCAGAAAGGAGT
TGFβ F: CCCTGGACACCAACTATTGC 131 NM 000660.7
R: GCAGAAGTTGGCATGGTAGC
GAPDH F: CCACTCCTCCACCTTTGAC 102 NM 002046.7
R: ACCCTGTTGCTGTAGCCA
Open in a new tab

2.4.1. Enzyme‐linked immunosorbent assay (ELISA)

The production of prostaglandin e2(PGE2) in cell lines and skin tissues was determined by a Prostaglandin E2 Parameter Assay Kit (R&D Systems, Minneapolis, MN, USA). The assay was performed according to the manufacturer's instructions.

2.5. Immunohistochemistry

Tissues were fixed in neutral buffered formalin overnight and embedded in paraffin. Tissue samples were sectioned (5 µm), deparaffinised, processed for antigen retrieval, blocked and incubated with the primary antibody (dilution 1:100) targeting the Ki‐67 antigen (cat# 9949, Cell Signalling Technology, MA, USA), VEGF (cat# ab1316, Abcam, CA, UK) and peroxidase‐conjugated secondary antibody. The samples were mounted and photographed using a LSM 800 confocal microscope (Zeiss, Oberkochen, Germany). For comparison among the experimental groups, images were captured at the same exposure time. For the peroxidase‐conjugated secondary antibody, 3,3‐diaminobenzidine substrate was used, followed by haematoxylin for nuclear counterstaining. Expressions of VEGF and Ki67+ cells were measured using the open‐source image analysis tool, Image J software (version 1.53 https://imagej.nih.gov/ij/index.html, National Institutes of Health, MD, USA).

2.6. Masson's trichrome staining

The experiments were performed according to the manufacturer's protocol (cat# IFU‐2, ScyTek, Logan, UT, USA). Deparaffinised slides were incubated with Weigert's iron haematoxylin, Biebrichscarlet‐acid fuchsin solution, phosphomolybdic‐phosphotungstic acid solution and aniline blue solution. The slides were then rinsed with 1% acetic acid solution. Collagen connective tissue showed a bluish colour. Dermal regeneration was calculated using the following formula: 100× collagen deposition (blue colour) length/total dermis layer length.

2.7. Statistical analysis

The comparison analysis was performed using Prism 7 (GraphPad Software, San Diego, CA, USA). All graphs are presented as the mean ± standard deviation. All experiments were performed in triplicate. Statistical analyses were performed using one‐way analysis of variance and two‐tailed Student's t‐test. Differences were considered statistically significant at p < 0.05.

3. RESULTS

3.1. A novel bentonite complex induces skin regeneration in a minipig burn wound model

Macroscopic observation revealed that the wound areas were not significantly different between the bentonite complex and control groups until day 21 (Figure 1). However, scabs were removed from the skin surface in the both bentonite complex groups and the PC group compared with the NC group. Histological analysis showed that collagen deposition significantly increased in the T1, T2 and PC groups than in the NC group (Figure 2). Consistent with the macroscopic findings, few scabs were detected in the bentonite complex treatment groups. Ki67+ cells significantly increased in the T1 and T2 groups, and the number of cells in the T1 group was greater than that in the PC group (Figure 3). Furthermore, the relative expression of VEGF also significantly increased in both the T1 and T2 groups as well as the PC group in contrast to that in the NC group (Figure 4).

FIGURE 1.

FIGURE 1

Open in a new tab

Macroscopic observation of minipig burn wounds. The pictures of wounds were taken on days 2, 10 and 21. The burns were induced on both sides of the back and sized 3 × 3 cm2. The bentonite complex and control agents were equally applied in a volume of 1 ml (NC = negative control; PC = positive control; T1 = 1 mg/ml bentonite complex; T2 = 6 mg/ml bentonite complex)

FIGURE 2.

FIGURE 2

Open in a new tab

Masson's trichrome staining of the dermis layer of burn wounds. (a) Microscopic observation of collagen deposition in the burn wounds. Collagen‐rich fibrotic region was marked in blue. Cytoplasm and muscle fibres were marked in red. S = Scab, E = Epidermis, D = Dermis. (b) Percentage of collagen deposition (Y‐axis) was determined by measuring the depth of collagen. All data are represented as mean ± standard deviation. Scale bars: 100 µm (NC = negative control; PC = positive control; T1 = 1 mg/ml bentonite complex; T2 = 6 mg/ml bentonite complex; n = 4; *p < 0.05, compared to the NC group)

FIGURE 3.

FIGURE 3

Open in a new tab

Immunohistochemistry analysis of Ki67 expression in burn wounds. Microscopic images of Ki67 staining in the burn wounds. Ki67 antigens were marked in brown, and nucleus was counterstained with haematoxylin (blue). (b) The number of Ki67+ cells (Y‐axis) was determined by counting the nuclei of Ki67+ cells. All data are represented as mean ± standard deviation. Scale bars: 100 µm (NC = negative control; PC = positive control; T1 = 1 mg/ml bentonite complex; T2 = 6 mg/ml bentonite complex; n = 4; *p < 0.05, ***p < 0.001 compared to the NC group; # p < 0.05, compared to PC group)

FIGURE 4.

FIGURE 4

Open in a new tab

Immunohistochemistry analysis of VEGF expression in burn wounds. (a) Microscopic images of VEGF staining in the burn wounds. VEGF were marked in brown and nuclei were marked in blue. (b) Relative expression of VEGF (Y‐axis) was determined by measuring brown area. All data are represented as mean ± standard deviation. Scale bars: 100 µm (NC = negative control; PC = positive control; T1 = 1 mg/ml bentonite complex; T2 = 6 mg/ml bentonite complex; n = 4; *p < 0.05, compared to NC group)

3.1.1. A novel bentonite complex inhibits COX‐2‐mediated inflammatory response on the burn wound

To identify skin regeneration by the anti‐inflammatory effect of the bentonite complex, the gene expression of the inflammatory markers was analysed. Expression of interleukin 1 beta (IL‐1β) and COX‐2 was significantly downregulated in T1, T2 and PC compared with that in the NC group (Figure 5a). In addition, the expression of the anti‐inflammatory cytokine interleukin 10 (IL‐10) significantly increased in T1, T2 and PC in contrast to that in the NC group. Consistent with the previous result, the production of PGE2, a potent inflammatory mediator synthesised by COX‐2, significantly decreased in the T1, T2 and PC groups in all minipigs (Figure 5b).

FIGURE 5.

FIGURE 5

Open in a new tab

Gene and protein expression of inflammatory cytokines in the burn wounds. (a) Expressions of IL‐1β, COX‐2 and IL‐10 were analysed using qRT‐PCR. (b) Comparison of PGE2 concentration in burn wounds of minipigs using ELISA. All samples were run in triplicate. All data are represented as mean ± standard deviation (NC = negative control; PC = positive control; T1 = 1 mg/ml bentonite complex; T2 = 6 mg/ml bentonite complex; n = 4; *p < 0.05; **p < 0.01, ***p < 0.001 ****p < 0.0001 compared to the NC group)

3.1.2. Bentonite clay mediates anti‐inflammatory response in vitro

To identify the anti‐inflammatory effect of bentonite clay in the bentonite complex, the expression of COX‐2‐mediated inflammatory cytokines and chemokines was analysed in HacaT keratinocytes and 3D4/2 macrophage cell lines. qRT‐PCR results showed that the expression of IL‐1β, COX‐2 and prostaglandin E synthase (PTGES) in 3D4/2 macrophage cells significantly decreased in all bentonite treatment groups. IL‐10, an anti‐inflammatory cytokine, also decreased but without statistical significance (Figure 6a). In HacaT keratinocytes, the expression of the same panels decreased in all bentonite treatment groups. However, IL‐10 significantly increased, contrary to the results of 3D4/2. PGE2 secretion in both HacaT and 3D4/2 cells decreased by bentonite (Figure 6b).

FIGURE 6.

FIGURE 6

Open in a new tab

Gene and protein expression analysis of COX‐2‐mediated inflammatory cytokines in HacaT and 3D4/2. (a) qRT‐PCR result represents COX‐2‐mediated inflammatory gene expression of HacaT and 3D4/2 after treatment of the water‐soluble fraction of the bentonite solution. (b) ELISA result measured production of PGE2 from HacaT and 3D4/2. All samples were run in triplicate. X‐axis indicates the dose of bentonite clay (µg/ml). All data are represented as mean ± standard deviation (NC = no treatment control; n = 3; *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.001, compared to the NC group)

To observe the direct anti‐inflammatory effect of bentonite on immune cells, 3D4/2 macrophages were pre‐treated with LPS to mimic the inflammatory response in vitro. As a result, the expression of IL‐1β, COX‐2, PTGES and other cytokines; tumour necrosis factor alpha (TNFα); interleukin 6(IL‐6); C‐C motif chemokine ligand 2 (CLL2) and C‐X‐C chemokine ligand 2 (CXCL2) were inhibited by treatment with bentonite clay (Figure 7).

FIGURE 7.

FIGURE 7

Open in a new tab

Gene expression analysis of inflammatory cytokines in LPS‐induced 3D4/2. The graph represents changes of inflammatory gene expression in LPS‐induced and conventional 3D4/2 cells after treatment with water‐soluble fraction of the bentonite solution. All samples were run in triplicate. X‐axis indicates the dose of bentonite clay (µg/ml). All data are represented as mean ± standard deviation (NC = no treatment control; LPS = lipopolysaccharide; n = 3; *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.001, compared with only treatment of LPS group)

4. DISCUSSION

In vivo study confirmed the therapeutic effect of a novel bentonite complex in burn wounds by inducing tissue regeneration without any toxicological response. Cell proliferation, angiogenesis and collagen deposition were activated in burn wounds after treatment with the bentonite complex (La Rosa et al., 2020; Murukesh et al., 2010; Rieppo et al., 2019). In addition, the quantity of scabs on the surface of wounds visibly decreased (especially in the males) in both macroscopic observation and Masson's trichrome staining. It suggests that the bentonite complex physically created moisture condition by acting as a barrier which blocks external exposure, leading to improve cell growth and tissue reconstruction (Field & Kerstein, 1994; Mircioiu et al., 2013; Ousey et al., 2016).

However, any significant wound contraction was not observed after treatment of the bentonite complex in macroscopic images (Figure 1). Our experimental schedule for wound healing may not have been sufficient for complete tissue remodelling, which is the final phase of skin regeneration (Bowden et al., 2016). A study reported that wound contraction could be delayed by physiological stress involved in myofibroblast differentiation (Horan et al., 2005).

Benotonite complex has also anti‐inflammatory function by inhibiting COX‐2‐mediated signalling at the gene and protein levels (Chen, 2010; Van Ryn et al., 2000). IL‐1β and COX‐2 were inhibited by the bentonite complex in the burn wounds. Otherwise, IL‐10, an anti‐inflammatory cytokine, was significantly increased (Figure 5a). Additionally, production of PGE2 was also significantly inhibited in the burn wounds after bentonite complex treatment (Kawahara et al., 2015). Taken together, in vivo study identified that the bentonite complex improved tissue repair and inhibited inflammatory response on the burn wounds by inhibiting COX‐2 pathway (Figure 8a).

FIGURE 8.

FIGURE 8

Open in a new tab

Graphical summary. (a) In vivo assay evaluated the therapeutic effect of a novel bentonite complex on the burn wound of a minipig by promoting tissue regeneration and inhibiting COX‐2‐mediated inflammatory response. (b) In vitro assay identified that the bentonite clay in the bentonite complex regulated inflammatory signalling by inhibiting COX‐2/PGE2 axis in inflammatory macrophages and activating anti‐inflammation in keratinocytes

In vitro study identified that bentonite clay, a major component of the bentonite complex, inhibited the expression of IL‐1β, COX‐2 and PTGES in 3D4/2 macrophages. Interestingly, the expression of IL‐10 was significantly increased in keratinocytes after treatment of bentonite clay. It indicates that bentonite complex activated IL‐10 production and induced tissue repairing as well as anti‐inflammatory effect (Opal & De Palo, 2000; King et al., 2014).

In addition, bentonite clay significantly inhibited inflammatory signalling of 3D4/2 macrophage activated by LPS to mimic inflammatory response in burn wound (Zhang et al., 2019). Expression of COX‐2‐mediated cytokines and chemokines was significantly increased in 3D4/2‐treated LPS only. But, they were suppressed by treatment of the bentonite clay solution, even compared with NC group. These findings implicated that skin‐resident macrophages were directed to M2 phase, promoting inhibition of inflammatory response and cell proliferation for tissue regeneration (Italiani & Boraschi, 2014; Figure 8b).

Nevertheless, the mechanism of how bentonite complex inhibited COX‐2 signalling in skin tissues was not identified in this study. Some papers reported that bentonite clay worked efficiently in healing of skin lesion in vitro condition and minerals such as calcium, zinc and coppers in bentonite clay induces cell proliferation (Cervini‐Silva et al., 2016; Sandri et al., 2014). However, specific mechanisms of bentonite in living organism are still elusive.

In conclusion, we verified the therapeutic effect of bentonite complex by tissue repair process in minipig burn wound model. Recently, bentonite clay has been recognised as common and familiar materials in human life (Moosavi, 2017; Srasra & Bekri‐Abbes, 2020). Thus, this study provides a scientific basis for developing bentonite‐based products for medical and cosmetic use.

AUTHOR CONTRIBUTIONS

Han Na Suh: investigation; methodology; visualisation. Kwan Young Choi: formal analysis; resources; validation. Chang Woo Song: supervision; writing – review & editing. Jeong Ho Hwang: conceptualisation; data curation; funding acquisition; project administration; writing – review & editing.

CONFLICT OF INTEREST

The authors declare that they have no competing interests.

CONSENT FOR PUBLICATION

All authors have consented to the submission of this manuscript for publication

ETHICS STATEMENT

All authors confirm that the ethical policies that described in journal's guideline. The animal experiments in this study were performed in accordance with the guidelines established by Institutional Animal Care and Use Committee at Korea institute of toxicology.

PEER REVIEW

The peer review history for this article is available at https://publons.com/publon/10.1002/vms3.908.

Supporting information

SUPPORTING INFORMATION

Click here for additional data file. (13.7KB, docx)

Lee, J. Y , Suh, H. N. , Choi, K. Y. , Song, C. W. , & Hwang, J. H. (2022). Regenerative and anti‐inflammatory effect of a novel bentonite complex on burn wounds. Veterinary Medicine and Science, 8, 2422–2433. 10.1002/vms3.908

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  1. Albanesi, C. , Madonna, S. , Gisondi, P. , & Girolomoni, G. (2018). The interplay between keratinocytes and immune cells in the pathogenesis of psoriasis. Frontiers of Immunology, 9, 1549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alden, N. E. , Rabbitts, A. , & Yurt, R. W. (2006). Contact burns: Is further prevention necessary? Journal of Burn Care & Research, 27, 472–475. [DOI] [PubMed] [Google Scholar]
  3. Alex, A. , Chaney, E. J. , Žurauskas, M. , Criley, J. M. , jr Spillman, D. R. ., Hutchison, P. B. , Li, J. , Marjanovic, M. , Frey, S. , Arp, Z. , & Boppart, S. A. (2020). In vivo characterization of minipig skin as a model for dermatological research using multiphoton microscopy. Experimental Dermatology, 29, 953–960. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Babahoum, N. , & Hamou, M. O. (2021). Characterization and purification of Algerian natural bentonite for pharmaceutical and cosmetic applications. BMC Chemistry, 15, 50. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bainbridge, P. (2013). Wound healing and the role of fibroblasts. Journal of Wound Care, 22, 410–412. [DOI] [PubMed] [Google Scholar]
  6. Bogaty, P. , Brophy, J. M. , Noel, M. , Boyer, L. , Simard, S. , Bertrand, F. , & Dagenais, G. R. (2004). Impact of prolonged cyclooxygenase‐2 inhibition on inflammatory markers and endothelial function in patients with ischemic heart disease and raised C‐reactive protein: A randomized placebo‐controlled study. Circulation, 110, 934–939. [DOI] [PubMed] [Google Scholar]
  7. Bowden, L. G. , Byrne, H. M. , Maini, P. K. , & Moulton, D. E. (2016). A morphoelastic model for dermal wound closure. Biomechanics and Modeling in Mechanobiology, 15, 663–681. [DOI] [PubMed] [Google Scholar]
  8. Branski, L. K. , Mittermayr, R. , Herndon, D. N. , Norbury, W. B. , Masters, O. E. , Hofmann, M. , Traber, D. L. , Redl, H. , & Jeschke, M. G. (2008). A porcine model of full‐thickness burn, excision and skin autografting. Burns, 34, 1119–1127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cancio, L. C. (2021). Topical antimicrobial agents for burn wound care: History and current status. Surgical Infection, 22, 3–11. [DOI] [PubMed] [Google Scholar]
  10. Cañedo‐Dorantes, L. , & Cañedo‐Ayala, M. (2019). Skin acute wound healing: A comprehensive review. International Journal of Inflammation, 2019, 3706315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cervini‐Silva, J. , Ramírez‐Apan, M. T. , Kaufhold, S. , Ufer, K. , Palacios, E. , & Montoya, A. (2016). Role of bentonite clays on cell growth. Chemosphere, 149, 57–61. [DOI] [PubMed] [Google Scholar]
  12. Chen, C. (2010). COX‐2's new role in inflammation. Nature Chemical Biology, 6, 401–402. [DOI] [PubMed] [Google Scholar]
  13. Colombo, I. , Sangiovanni, E. , Maggio, R. , Mattozzi, C. , Zava, S. , Corbett, Y. , Fumagalli, M. , Carlino, C. , Corsetto, P. A. , Scaccabarozzi, D. , Calvieri, S. , Gismondi, A. , Taramelli, D. , & Dell'Agli, M. (2017). HaCaT cells as a reliable in vitro differentiation model to dissect the inflammatory/repair response of human keratinocytes. Mediators of Inflammation, 2017, 7435621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Eming, S. A. , Krieg, T. , & Davidson, J. M. (2007). Inflammation in wound repair: Molecular and cellular mechanisms. Journal of Investigative Dermatology, 127, 514–525. [DOI] [PubMed] [Google Scholar]
  15. Evers, L. H. , Bhavsar, D. , & Mailänder, P. (2010). The biology of burn injury. Experimental Dermatology, 19, 777–783. [DOI] [PubMed] [Google Scholar]
  16. Field, F. K. , & Kerstein, M. D. (1994). Overview of wound healing in a moist environment. The American Journal of Surgery, 167, 2S–6S. [DOI] [PubMed] [Google Scholar]
  17. Gantwerker, E. A. , & Hom, D. B. (2011). Skin: Histology and physiology of wound healing. Facial Plastic Surgery Clinics of North America, 19, 441–453. [DOI] [PubMed] [Google Scholar]
  18. Horan, M. P. , Quan, N. , Subramanian, S. V. , Strauch, A. R. , Gajendrareddy, P. K. , & Marucha, P. T. (2005). Impaired wound contraction and delayed myofibroblast differentiation in restraint‐stressed mice. Brain, Behavior, and Immunity, 19, 207–216. [DOI] [PubMed] [Google Scholar]
  19. Italiani, P. , & Boraschi, D. (2014). From monocytes to M1/M2 macrophages: Phenotypical vs. functional differentiation. Frontiers of Immunology, 5, 514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kawahara, K. , Hohjoh, H. , Inazumi, T. , Tsuchiya, S. , & Sugimoto, Y. (2015). Prostaglandin E2‐induced inflammation: Relevance of prostaglandin E receptors. Biochimica et Biophysica Acta, 1851m, 414–421. [DOI] [PubMed] [Google Scholar]
  21. King, A. , Balaji, S. , Le, L. D. , Crombleholme, T. M. , & Keswani, S. G. (2014). Regenerative wound healing: The role of interleukin‐10. Advances in Wound Care, 3, 315–323. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. La Rosa, S. , Bonzini, M. , Sciarra, A. , Asioli, S. , Maragliano, R. , Arrigo, M. , Foschini, M. P. , Righi, A. , Maletta, F. , Motolese, A. , Papotti, M. , Sessa, F. , & Uccella, S. (2020). Exploring the prognostic role of Ki67 proliferative index in merkel cell carcinoma of the skin: clinico‐pathologic analysis of 84 cases and review of the literature. Endocrine Pathology, 31, 392–400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Mircioiu, C. , Voicu, V. A., Lonescu, M. , Miron, D. S. , Radulescu, F. S. , & Nicolescu, A. C. (2013). Evaluation of in vitro absorption, decontamination and desorption of organophosphorous compounds from skin and synthetic membranes. Toxicology Letters, 219, 99–106. [DOI] [PubMed] [Google Scholar]
  24. Momcilović, D. (2002). Topical agents used in the treatment of burns. Medicinski Pregled, 55, 109–113. [DOI] [PubMed] [Google Scholar]
  25. Moosavi, M. (2017). Bentonite clay as a natural remedy: A brief review. Iranian Journal of Public Health, 46, 1176–1183. [PMC free article] [PubMed] [Google Scholar]
  26. Murukesh, N. , Dive, C. , & Jayson, G. C. (2010). Biomarkers of angiogenesis and their role in the development of VEGF inhibitors. British Journal of Cancer, 102, 8–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Nones, J. , Riella, H. G. , Trentin, A. G. , & Nones, J. (2015). Effects of bentonite on different cell types: A brief review. Applied Clay Science, 105, 225–230. [Google Scholar]
  28. Opal, S. M. , & De Palo, V. A. (2000). Anti‐inflammatory cytokines. Chest, 117, 1162–1172. [DOI] [PubMed] [Google Scholar]
  29. Ousey, K. , Cutting, K. F. , Rogers, A. A. , & Rippon, M. G. (2016). The importance of hydration in wound healing: Reinvigorating the clinical perspective. Journal of Wound Care, 25(122), 124–130. [DOI] [PubMed] [Google Scholar]
  30. Park, J. H. , Shin, H. J. , Kim, M. H. , Kim, J. S. , Kang, N. , Lee, J. Y. , Kim, K. T. , Lee, J. I. , & Kim, D. D. (2016). Application of montmorillonite in bentonite as a pharmaceutical excipient in drug delivery systems. Journal of Pharmceutical Investigation, 46, 363–375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Rieppo, L. , Janssen, L. , Rahunen, K. , Lehenkari, P. , Finnilä, M. A. J. , & Saarakkala, S. (2019). Histochemical quantification of collagen content in articular cartilage. PLoS One, 14, e0224839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Rodrigues, M. , Kosaric, N. , Bonham, C. A. , & Gurtner, G. C. (2019). Wound healing: A cellular perspective. Physiological Reviews, 99, 665–706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Sandri, G. , Bonferoni, M. C. , Ferrari, F. , Rossi, S. , Aguzzi, C. , Mori, M. , Grisoli, P. , Cerezo, P. , Tenci, M. , Viseras, C. , & Caramella, C. (2014). Montmorillonite‐chitosan‐silver sulfadiazine nanocomposites for topical treatment of chronic skin lesions: In vitro biocompatibility, antibacterial efficacy and gap closure cell motility properties. Carbohydrate Polymers, 102, 970–977. [DOI] [PubMed] [Google Scholar]
  34. Seaton, M. , Hocking, A. , & Gibran, N. S. (2015). Porcine models of cutaneous wound healing. ILAR Journal, 56, 127–138. [DOI] [PubMed] [Google Scholar]
  35. Singer, A. J. , & Boyce, S. T. (2017). Burn wound healing and tissue engineering. Journal of Burn Care Research, 38, e605–613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Singer, A. J. , Hirth, D. , McClain, S. A. , Crawford, L. , Lin, F. , & Clark, R. A. (2011). Validation of a vertical progression porcine burn model. Journal of Burn Care Research, 32, 638–646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Srasra, E. , & Bekri‐Abbes, I. (2020). Bentonite clays for therapeutic purposes and biomaterial design. Current Pharmaceutical Design, 26, 642–649. [DOI] [PubMed] [Google Scholar]
  38. Summerfield, A. , Meurens, F. , & Ricklin, M. E. (2015). The immunology of the porcine skin and its value as a model for human skin. Molecular Immunology, 66, 14–21. [DOI] [PubMed] [Google Scholar]
  39. Tiwari, V. K. (2012). Burn wound: How it differs from other wounds? Indian Journal of Plastic Surgery, 45, 364–373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Van Ryn, J. , Trummlitz, G. , & Pairet, M. (2000). COX‐2 selectively and inflammatory processes. Current Medicinal Chemistry, 7, 1145–1161. [DOI] [PubMed] [Google Scholar]
  41. Williams, L. B. , & Haydel, S. E. (2010). Evaluation of the medicinal use of clay minerals as antibacterial agents. International Geology Review, 52, 745–770. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Zhang, J. , Zheng, Q. , Lu, H. , Jin, F. , Li, Y. , Bi, F. , & Xu, J. (2019). Notoginsenoside R1 protects human keratinocytes HaCaT from LPS‐induced inflammatory injury by downregulation of Myd88. International Journal of Immunopathology and Pharmacology, 33, 1–10. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

SUPPORTING INFORMATION

Click here for additional data file. (13.7KB, docx)

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from Veterinary Medicine and Science are provided here courtesy of Wiley

RESOURCES