Abstract
Background:
Identification of genotypic characteristics and pathogenicity of Staphylococcus aureus isolates is very important in the epidemiological study of its related diseases.
Aims:
The present study was done to compare the S. aureus isolates from different sources on the basis of virulence gene properties, biofilm production ability, and phylogenetic variations.
Methods:
Seventy S. aureus isolates (including 25 human, 25 raw milk, and 20 pet animal isolates) were subjected to slime production ability testing, polymerase chain reaction (PCR) detection of 14 different virulence genes, and DNA fingerprinting using restriction fragment length polymorphism (RFLP) of coa gene PCR products.
Results:
Among 70 S. aureus, 64 (91.4%) isolates were slime producers on Congo red agar (CRA) medium. The spa and icaD virulence genes were present in all isolates and the seD and etaA genes were not detected in any of the isolates. In total, 22 different virulence gene patterns and nine distinct clusters of coa-PCR-RFLP were identified among isolates.
Conclusion:
According to the results, S. aureus strains of human origin showed a significant association with specific virulence gene profiles and genotypes. seB and seC were the most responsible genes for S. aureus enterotoxin among human and animal isolates, respectively. Coa-RFLP showed partially appropriate results in the classification and source detection of S. aureus isolates.
Key Words: Biofilm, PCR-RFLP, Staphylococcus aureus, Virulence factors
Introduction
Staphylococcus aureus the Gram-positive bacterium is one of the most prevalent and important infectious agents in human and animals (Zimmerli et al., 2004 ▶). This bacterium carries a variety of virulence genes related to infectious diseases. More precisely, S. aureus harbors abundant numbers of toxins, enzymes, and other virulent factors including cell surface components such as protein A, fibronectin-binding protein, collagen binding protein, and clumping factor, and exoproteins such as enterotoxins, exfoliatins, toxic shock syndrome toxin, coagulase protein, and Panton-Valentine leucocidin (PVL) (Al-Mebairik et al., 2016 ▶; Cheung et al., 2021 ▶). The presence of these potent virulence agents allows the bacterium to show different forms and symptoms in the related infections. Along with this condition, the presence of this bacterium as a human microbial flora and the ability of S. aureus in transmission through food, as well as the possibility of spreading infections through animals doubles the importance of this microorganism. In addition, S. aureus has the capacity to adhere to devices such as medical catheters and it forms biofilm which can make the microorganism more resistant to antibiotics and it can cause the transmission of the bacterium (Halim et al., 2018 ▶). Transmission of resistant strains of this bacterium, especially methicillin resistant S. aureus (MRSA) strains from companion animals to humans has been proven. Reports of identification of these strains have been obtained from different countries (Aires-de-Sousa, 2017 ▶). Nevertheless, what causes common infections between humans and animals as potential sources of the bacterium and incidence of the similar symptoms is the presence of specific virulence factors among the common strains of the bacterium that circulate regularly among humans, companion animals, foods, and food animals in different ways. Therefore, the present study was conducted to assess the possible associations between human and animal S. aureus isolates. As a result, the isolates of S. aureus obtained from humans, raw milk (dairy retail shops), and pet animals (dogs and cats) were compared for phenotypic and genotypic biofilm formation ability, their content of different virulent genes, and DNA fingerprinting using valuable coa-PCR-RFLP method.
Materials and Methods
Bacterial isolates and DNA extraction
In the present study, a total of 70 S. aureus isolates that had been previously isolated and stored at -20°C in the microbiology laboratory of the Faculty of Veterinary Medicine, Amol University of Special Modern Technologies were considered for investigation. The isolates were recovered from sampling process during the summer of 2020 from human cases referred to laboratories, pets referred to veterinary clinics, and raw milk retail shops in the city of Amol, northern Iran. Necessary ethical permission to conduct this study was obtained from Amol University of Special Modern Technologies Ethics Committee with the code of ethics IR.AUSMT.REC.1400.15. (Pahlavanzadeh et al., 2021 ▶). DNA extraction from S. aureus isolates was done using gram positive DNA extraction kit (Sinaclon, Tehran, Iran) according to the manufacturer’s instructions. The extracted DNA and the isolates were stored at -20°C for use in other steps of the study.
Biofilm formation assay
Detection of biofilm formation was performed by culturing the S. aureus isolated on Congo red agar (CRA) containing 0.8 g of Congo red dye and 36 g saccharose (HiMedia, India) according to the previously described method (Zmantar et al., 2008 ▶). The isolates were incubated at 37°C for 24 h under aerobic condition and, finally, the results were interpreted as follows: very black, black, and almost black with a rough, dry, and crystalline consistency on CRA were considered to be strong biofilm-producing strains; reddish-black colonies were considered as moderate biofilm; red or pink colonies with a rough appearance indicate the formation of a weak biofilm, while very red, red, and smooth colonies were classified as non-biofilm-producing strains, as previously described (Freeman et al., 1989 ▶; Arciola et al., 2002 ▶).
Detection of biofilm and virulence genes
The isolates were examined for the presence of 14 virulence genes in order to determine the potential differences in the presence of the genes in S. aureus isolates obtained from different sources. SeA, seB, seC, seD, and seE related to Staphylococcus enterotoxins, hlyA, and hlyB related to heamolysin production, etaA, and etaB genes related to exfoliatin toxin, icaA and icaD for biofilm production, pvl gene related to panton-valentine leukocidin (pvl) toxin, tsst-1 gene for toxic shock syndrome, and toxin-1 and spa gene for S. aureus immunoglobulin G-binding protein A were all subjected to detection. PCR was performed using specific primers (Table 1) in the final volume of 25 μL (including 12.5 µL of a PCR master mix (Sinaclon, Iran), 1 μL (0.5 μM) of both forward and reverse primers and 2 µL of each DNA) (Lina et al., 1999 ▶; Mehrotra et al., 2000 ▶; Jarraud et al., 2002 ▶; Vasudevan et al., 2003 ▶). Then the PCR products were evaluated and confirmed using electrophoresis in 1.5% agarose gel with the assistance of the 100 bp DNA marker (Sinaclon, Iran). Different virulent gene patterns were described according to the presence of the genes.
Table 1.
Nucleotide sequences used as primers in PCR for identification of S. aureus virulence genes
| Target gene | Sequence (5´ to 3´) | Annealing temperature (°C) | PCR product size (bp) | Reference |
|---|---|---|---|---|
| seA | F: GGTTATCAATGTGCGGGTGG R: CGGCACTTTTTTCTCTTCGG |
52 | 102 | |
| seB | F: GTATGGTGGTGTAACTGAGC R: CCAAATAGTGACGAGTTAGG |
49 | 164 | |
| seC | F: AGATGAAGTAGTTGATGTGTATGG R: CACACTTTTAGAATCAACCG |
50 | 451 | |
| seD | F: CCAATAATAGGAGAAAATAAAAG R: ATTGGTATTTTTTTTCGTTC |
45 | 278 | |
| seE | F: AGGTTTTTTCACAGGTCATCC R: CTTTTTTTTCTTCGGTCAATC |
50 | 209 | |
| hlyA | F: CTGATTACTATCCAAGAAATTCGATTG R: CTTTCCAGCCTACTTTTTTATCAGT |
52 | 210 | |
| hlyB | F: GTGCACTTACTGACAATAGTGC R: GTTGATGAGTAGCTACCTTCAGT |
52 | 310 | |
| etaA | F: GCAGGTGTTGATTTAGCATT R: AGATGTCCCTATTTTTGCTG |
48 | 93 | |
| etaB | F: ACAAGCAAAAGAATACAGCG R: GTTTTTGGCTGCTTCTCTTG |
49 | 226 | |
| icaA | F: CCTAACTAACGAAAGGTAG R: AAGATATAGCGATAAGTGC |
44 | 1315 | |
| icaD | F: AAACGTAAGAGAGGTGG R: GGCAATATGATCAAGATA |
45 | 381 | |
| pvl | F: ATCATTAGGTAAAATGTCTGGACATGATCCA R: GCATCAAGTGTATTGGATAGCAAAAGC |
56 | 433 | |
| Tsst-1 | F: ACCCCTGTTCCCTTATCATC R: TTTTCAGTATTTGTAACGCC |
50 | 326 | |
| spa | F: TCAACAAAGAACAACAAAATGC R: GCTTTCGGTGCTTGAGATTC |
51 | 226 |
F: Forward, and R: Reverse
DNA fingerprinting and phylogenetic tree
The genetic similarity of the isolates was analyzed by coa-PCR-RFLP technique as previously described (Goh et al., 1992 ▶). In the first testing step, coa gene was partially amplified, using forward: 5´-ACC ACA AGG TAC TGA ATC AAC G-3´ and reverse: 5´- TGC TTT CGA TTG TTC GAT GC-3´ primers which produce 570-970 bp products. The PCR reaction mixture was prepared as stated in previous experiments. The program was run in the PCR machine as follows: initial denaturation was set at 94°C for 4 min, followed by 36 cycles of denaturation at 94°C for 40 s, annealing at 57°C for 40 s, extension at 72°C for 60 s, and a final extension step at 72°C for 7 min. Then PCR products were digested with AluI enzyme (Fermentas, USA). For this purpose, 10.5 μL of distilled water, 2.5 μL of 10X restriction buffers, and 7 μL of the purified PCR products were mixed with 2 U of AluI. The mixture was incubated at 37°C for 1 h. Finally, the product obtained by RFLP method was analyzed using electrophoresis in 2.5% agarose gel and the images of RFLP reactions were loaded in GelClust software for analysis. Genetic similarity was calculated using the Pearson correlation in which 2% of the optimization tolerance and 4% of the position tolerance shift were set. The dendrogram of the isolates was also created by the Dice correlation coefficient and the un-weighted pair group method with arithmetic averages (UPGMA).
Statistical analysis
The results of the study on different variables were analyzed using SPSS version 22 software (IBM Armonk, North Castle, NY, USA). Statistical analyses were carried out with a statistical significant P<0.05.
Results
Among 70 S. aureus isolates, 64 (91.4%) isolates demonstrated the ability to produce biofilms on the congo red agar medium. The highest number of strong biofilm producer isolates was observed in human origin. Detailed results of the slime production of the isolates have been shown in Table 2. The spa and icaD genes were detected among all 70 isolates and after them the most prevalent virulent genes were hlyA and icaA with the frequency of 69 (98.5%) and 67 (95.7%), respectively. The seD and etaA genes were not identified in any of the isolates (Table 3). The prevalence of the virulence genes among the isolates showed 22 different virulence gene patterns in which the seC/hlyA/hlyB/ icaA/icaD/spa pattern were the most prevalent genes with the frequency of 19 (27.1%). The highest number of virulent gene patterns was observed in human isolates and only one virulence gene pattern was common among three different sources (Table 4). All isolates were typed by coa-PCR-RFLP (Figs. 1, 2 and 3). According to the analysis of coa-PCR-RFLP fingerprinting, nine distinct clusters (SID = 0.14 and Shannon Entropy = 2.0680) named R-1 to R-13, were identified, the most prevalent genotype of which was the R-8 cluster (Fig. 4). The genotypes R-2 and R-7 were only associated with human isolates and R-8 genotype was significantly associated with pet isolates (P<0.05). Human and raw milk isolates showed more common genotypic patterns in comparison with pet isolates (Table 5). Statistical analysis revealed that the difference between the isolates in biofilm production was not significant (P>0.05) but the production of biofilm in raw milk isolates was lower than that of the other two origins. A significant relationship was observed between the presence of the seB (higher occurrence) and seC (lower occurrence) genes and human isolates (P<0.05). All isolates with strong biofilm production had both icaA and icaD genes, but there were not any significant relationship between the biofilm formation and the presence of these two related genes. Prevalence of other virulent genes was not different significantly among isolates from the three various sources (P>0.05).
Table 2.
Slime production ability of the S. aureus isolates
| Source of sample | Biofilm formation status (%) | Total biofilm producers | ||
|---|---|---|---|---|
| No biofilm | Poor/moderate biofilm | Strong biofilm | ||
| Human (n=25) | 2 (8) | 13 (52) | 10 (40) | 23 (92) |
| Raw milk (n=25) | 4 (16) | 15 (60) | 6 (24) | 21 (84) |
| Pet (n=20) | 0 (0) | 14 (70) | 6 (30) | 20 (100) |
| Total (n=70) | 6 (8.5) | 42 (60) | 22 (31.4) | 64 (91.4) |
Table 3.
Distribution of virulence genes among S. aureus isolates
| Origin of isolates | Virulence gene distribution (%) | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| seA | seB | seC | seD | seE | hlyA | hlyB | etaA | etaB | icaA | icaD | pvl | tsst-1 | spa | |
| Human (n=25) |
2 (8) |
20 (80) |
9 (36) |
0 (0) |
1 (4) |
25 (100) |
3 (12) |
0 (0) |
2 (8) |
25 (100) |
25 (100) |
0 (0) |
6 (24) |
25 (100) |
| Raw milk (n=25) |
3 (12) |
0 (0) |
25 (100) |
0 (0) |
4 (16) |
24 (96) |
20 (80) |
0 (0) |
0 (0) |
23 (92) |
25 (100) |
3 (12) |
0 (0) |
25 (100) |
| Total (n=70) |
5 (7.1) |
28 (40) |
54 (77.1) |
0 (0) |
6 (8.5) |
69 (98.5) |
35 (50) |
0 (0) |
2 (2.8) |
67 (95.7) |
70 (100) |
3 (4.2) |
7 (10) |
70 (100) |
Table 4.
Virulence gene profiles of the S. aureus isolates obtained from different sources
| Virulence gene profiles | Number of isolates | |||
|---|---|---|---|---|
| Human | Pet | Raw milk | Total | |
| seC/hlyA/icaD/spa | - | 1 | - | 1 |
| hlyA/icaA/icaD/spa | 2 | - | - | 2 |
| seB/hlyA/icaA/icaD/spa | 8 | - | - | 8 |
| seC/hlyA/icaA/icaD/spa | 2 | 1 | 5 | 8 |
| seC/hlyA/hlyB/icaD/spa | - | - | 2 | 2 |
| hlyA/hlyB/icaA/icaD/spa | 1 | - | - | 1 |
| seC/hlyB/icaA/icaD/pvl/spa | - | - | 1 | 1 |
| seA/seB/hlyA/icaA/icaD/spa | 1 | - | - | 1 |
| seC/seE/hlyA/icaA/icaD/spa | - | 1 | - | 1 |
| seB/seC/hlyA/icaA/icaD/spa | 2 | 5 | - | 7 |
| seB/hlyA/hlyB/icaA/icaD/spa | 2 | - | - | 2 |
| seC/hlyA/hlyB/icaA/icaD/spa | - | 8 | 11 | 19 |
| seB/hlyA/icaA/icaD/tsst-1/spa | 1 | - | - | 1 |
| seC/hlyA/hlyB/icaA/icaD/pvl/spa | - | - | 2 | 2 |
| seB/seC/hlyA/hlyB/icaA/icaD/spa | - | 3 | - | 3 |
| seC/seE/hlyA/hlyB/icaA/icaD/spa | - | - | 1 | 1 |
| seB/seC/hlyA/etaB/icaA/icaD/spa | 1 | - | - | 1 |
| seA/seB/hlyA/icaA/icaD/tsst-1/spa | 1 | - | - | 1 |
| seB/seC/hlyA/icaA/icaD/tsst-1/spa | 3 | - | - | 3 |
| seC/hlyA/hlyB/icaA/icaD/tsst-1/spa | - | 1 | - | 1 |
| seA/seC/seE/hlyA/hlyB/icaA/icaD/spa | - | - | 3 | 3 |
| seB/seC/seE/hlyA/etaB/icaA/icaD/tsst-1/spa | 1 | - | - | 1 |
| Number of patterns | 12 | 7 | 7 | 22 |
Fig. 1.
coa-PCR-RFLP results of the S. aureus isolates obtained from human samples. Lane M: 100 bp DNA marker. Lanes H1-H25: AluI digestion of coa gene of 25 human S. aureus isolates
Fig. 2.
coa-PCR-RFLP results of the S. aureus isolates obtained from raw milk samples. Lane M: 100 bp DNA marker. Lanes D1-D25: AluI digestion of coa gene of 25 raw milk S. aureus isolates
Fig. 3.
coa-PCR-RFLP results of the S. aureus isolates obtained from pet animal samples. Lane M: 100 bp DNA marker. Lanes P1-P20: AluI digestion of coa gene of 20 pet animal S. aureus isolates
Fig. 4.
Dendrogram of coa-PCR-RFLP results of the S. aureus isolates drawn using the GelClust software in comparison with virulence gene pattern and slime production status
Table 5.
Distribution of the coa-RFLP fingerprinting genotypes
| Biological origin of isolate/No. | Frequency of coa-PCR-RFLP patterns (%) | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| R1 | R2 | R3 | R4 | R5 | R6 | R7 | R8 | R9 | |
| Human/25 | 1 (4) | 3 (12) | 7 (28) | 4 (14) | 3 (12) | 4 (16) | 3 (12) | 0 (0) | 0 (0) |
| Pets/20 | 3 (15) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 1 (5) | 0 (0) | 14 (70) | 2 (10) |
| Raw milk/25 | 4 (16) | 0 (0) | 6 (24) | 1 (24) | 3 (12) | 5 (20) | 0 (0) | 1 (4) | 5 (20) |
| Total/70 | 8 (11.4) | 3 (4.2) | 13 (18.5) | 5 (7.1) | 6 (8.5) | 10 (14.2) | 3 (4.2) | 15 (21.4) | 7 (20) |
Discussion
S. aureus slime production has been considered as an important virulence aspect contributing to infections associated with medical devices and causing nosocomial infections (Halim et al., 2018 ▶). The ability to produce biofilms between pet and raw milk isolates makes them more important in human staphylococcal infections. It has already been shown that the presence of icaA and icaD genes is associated with biofilm production among isolates of catheter-related infections in humans (Arciola et al., 2001 ▶). In the present study, despite the fact that all strong biofilm producing isolates had both genes and human isolates showing more production of strong slime, there was no significant association between the presence of the genes and the quality of biofilm production. It seems that the other genes of icaADBC operon, icaB, and icaC could play a greater role in producing weak and moderate forms of the slime layer than what it was previously thought. Another remarkable point in the biofilm production by isolates was the high percentage of biofilm-producing isolates on the CRA medium compared to other similar studies (Ciftci et al., 2009 ▶; Taj et al., 2012 ▶; Halim et al., 2018 ▶). From this perspective, CRA medium showed good results in detecting biofilm-producing strains by identifying weak, moderate, and strong slime production ability of the isolates.
Staphylococcal enterotoxins (SEA to SEE) are known as the common causes of human disease. Cheraghi et al. (2017) ▶ in their study on methicillin resistant S. aureus (MRSA) isolated from human clinical samples indicated that the most frequent toxin genes among their isolates were see gene (40.5%) followed by sea (26.7%) and the presence of seb and seh were not obvious in their isolates. In another study, the prevalence of enterotoxigenic S. aureus isolates in pork samples was 82.61%, and of the various toxin genes sei was the major gene followed by seg, seb, sej, sed, seh, sec, and sea (Savariraj et al., 2019 ▶). In the present study, the most prevalent staphylococcal enterotoxin genes among human and animal isolates were significantly different (P<0.05), seB and seC respectively, and seD were not found among the isolates. Similar differences were observed with other genes, so that hlyB and pvl genes being more prevalent among animal isolates. On the other hand, this was the case with the etaB and tsst genes in reverse where the presence of these genes was higher in human isolates. In fact, according to the results, the predominant pattern of the presence of virulence genes was also different between animal and human isolates. Other similar studies previously showed massive presence of twenty-six genes in S. aureus isolates obtained from bovine mastitis in Italy which indicate the potential virulence properties of animal S. aureus strains (Magro et al., 2017 ▶).
Previous studies have shown that the coa-RFLP based genotyping method has shown acceptable results in comparison with even pulse field gel electrophoresis (PFGE) method for classification and origin expectation of S. aureus isolates from different sources. These studies reported various numbers of RFLP genotypes (patterns) which could partially identify the source of infection (Dendani et al., 2016 ▶; Mohajeri et al., 2016 ▶). Hakimi Alni et al. (2017) ▶ found that most of the isolates from pastry showed 860 bp DNA fragment in coa gene PCR and the majority of cheese isolates showed a 970 bp DNA fragment related to the coa gene. Nevertheless, it seems that the coa gene PCR products from S. aureus isolates, regardless of the origin of the samples, could be 570 to 900 bp long and this point cannot be significant. In fact, the results of the enzymatic digestion will help to distinguish the source of the samples (Tiwari et al., 2008 ▶; Mahmoudi et al., 2017 ▶). In our study, in line with others, the AluI enzyme showed good enzymatic digestion on coa gene PCR products which was effective in better separation of bands and prediction of differences (Sohail and Latif, 2018 ▶; Aalaa’A and Abd Al-Abbas, 2019 ▶). As a final point, the results of the present study, in accordance with others, demonstrated that S. aureus isolates from human, pet, and raw milk samples are genetically varied, and that they can be typed by coa-PCR-RFLP technique. In conclusion, the results of the present study indicate that S. aureus strains with biofilm formation ability and possible pathogenicity properties are commonly present in pet animals and raw milk samples. A lot of animal isolates carried important virulence genes which suggest a possible origin of transmission of virulence to human strains. Coa-PCR-RFLP fingerprinting of S. aureus isolates revealed appropriate separation and identification power which can be used for determining the origin of infections in humans and animals.
Conflict of interest
Authors have no conflict of interest.
Acknowledgements
This study was supported by Islamic Azad University, Shiraz Branch, Shiraz, Iran and Amol University of Special Modern Technologies, Amol, Iran.
References
- Aalaa’A C, Abd Al-Abbas MJ. PCR-RFLP by AluI for coa gene of methicillin-resistant Staphylococcus aureus (MRSA) isolated from burn wounds, pneumonia and otitis media. Gene Rep. 2019;15:100390. [Google Scholar]
- Aires-de-Sousa M. Methicillin-resistant Staphylo-coccus aureus among animals: current overview. Clin. Microbiol. Infect. 2017;23:373–380. doi: 10.1016/j.cmi.2016.11.002. [DOI] [PubMed] [Google Scholar]
- Al-Mebairik NF, El-Kersh TA, Al-Sheikh YA, Marie MAM. A review of virulence factors, pathogenesis, and antibiotic resistance in Staphylococcus aureus. Rev. Med. Microbiol. 2016;27:50–56. [Google Scholar]
- Arciola CR, Baldassarri L, Montanaro L. Presence of icaA and icaD genes and slime production in a collection of staphylococcal strains from catheter-associated infections. J. Clin. Microbiol. 2001;39:2151–2156. doi: 10.1128/JCM.39.6.2151-2156.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Arciola CR, Campoccia D, Gamberini S, Cervellati M, Donati E, Montanaro L. Detection of slime production by means of an optimised Congo red agar plate test based on a colourimetric scale in Staphylococcus epidermidis clinical isolates genotyped for ica locus. Biomaterials. . 2002;23:4233–4239. doi: 10.1016/s0142-9612(02)00171-0. [DOI] [PubMed] [Google Scholar]
- Cheraghi S, Pourgholi L, Shafaati M, Fesharaki SH, Jalali A, Nosrati R, Boroumand MA. Analysis of virulence genes and accessory gene regulator (agr) types among methicillin-resistant Staphylococcus aureus strains in Iran. J. Glob. Antimicrob. Resist. 2017;10:315–320. doi: 10.1016/j.jgar.2017.06.009. [DOI] [PubMed] [Google Scholar]
- Cheung GY, Bae JS, Otto M. Pathogenicity and virulence of Staphylococcus aureus. Virulence. 2021;12:547–569. doi: 10.1080/21505594.2021.1878688. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ciftci A, Findik A, Onuk EE, Savasan S. Detection of methicillin resistance and slime factor production of Staphylococcus aureus in bovine mastitis. Braz. J. Microbiol. 2009;40:254–261. doi: 10.1590/S1517-83822009000200009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dendani ZC, Bezille P, Arcangioli MA. PCR and PCR-RFLP genotyping of Staphylococcus aureus coagulase gene: convenience compared to pulse-field gel electrophoresis. Comp. Clin. Path. 2016;25:1061–1064. [Google Scholar]
- Freeman DJ, Falkiner FR, Keane CT. New method for detecting slime production by coagulase negative staphylococci. J. Clin. Path. 1989;42:872–874. doi: 10.1136/jcp.42.8.872. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Goh SH, Byrne SK, Zhang JL, Chow AW. Molecular typing of Staphylococcus aureus on the basis of coagulase gene polymorphisms. J. Clin. Microbiol. 1992;30:1642–1645. doi: 10.1128/jcm.30.7.1642-1645.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hakimi Alni R, Mohammadzadeh A, Mahmoodi P, Alikhani MY. Genotypic analysis of Staphylo-coccus aureus coagulase gene using PCR-RFLP analysis. Med. Lab. J. 2017;11:12–17. [Google Scholar]
- Halim RMA, Kassem NN, Mahmoud BS. Detection of biofilm producing staphylococci among different clinical isolates and its relation to methicillin susceptibility. Open Access. Maced. J. Med. Sci. 2018;6:1335–1341. doi: 10.3889/oamjms.2018.246. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jarraud S, Mougel C, Thioulouse J, Lina G, Meugnier H, Forey F, Nesme X, Etienne J, Vandenesch F. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infect. Immun. 2002;70:631–641. doi: 10.1128/IAI.70.2.631-641.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lina G, Piémont Y, Godail-Gamot F, Bes M, Peter MO, Gauduchon V, Vandenesch F, Etienne J. Involvement of Panton-Valentine leukocidin—producing Staphylococcus aureus in primary skin infections and pneumonia. Clin. Infect. Dis. 1999;29:1128–1132. doi: 10.1086/313461. [DOI] [PubMed] [Google Scholar]
- Magro G, Biffani S, Minozzi G, Ehricht R, Monecke S, Luini M, Piccinini R. Virulence genes of S aureus from dairy cow mastitis and contagiousness risk. Toxins. . 2017;9:195. doi: 10.3390/toxins9060195. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mahmoudi H, Arabestani MR, Mousavi SF, Alikhani MY. Molecular analysis of the coagulase gene in clinical and nasal carrier isolates of methicillin-resistant Staphylococcus aureus by restriction fragment length polymorphism. J. Glob. Antimicrob. Resist. 2017;8:41–45. doi: 10.1016/j.jgar.2016.10.007. [DOI] [PubMed] [Google Scholar]
- Mehrotra M, Wang G, Johnson WM. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. J. Clin. Microbial. 2000;38:1032–1035. doi: 10.1128/jcm.38.3.1032-1035.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mohajeri P, Azizkhani S, Farahani A, Norozi B. Genotyping of coa and aroA genes of methicillin-resistant Staphylococcus aureus strains isolated from nasal samples in western Iran. Jundishapur J. Microbiol. 2016;9:e26460. doi: 10.5812/jjm.26460. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Pahlavanzadeh S, Khoshbakht R, Kaboosi H, Moazamian E. Antibiotic resistance and phylogenetic comparison of human, pet animals and raw milk Staphylococcus aureus isolates. Comp. Immunol. Microbiol. Infect. Dis. 2021;79:101717. doi: 10.1016/j.cimid.2021.101717. [DOI] [PubMed] [Google Scholar]
- Savariraj WR, Ravindran NB, Kannan P, Paramasivam R, Senthilkumar TMA, Kumarasamy P, Rao VA. Prevalence, antimicrobial susceptibility and virulence genes of Staphylococcus aureus isolated from pork meat in retail outlets in India. J. Food Saf. 2019;39:e12589. [Google Scholar]
- Sohail M, Latif Z. Molecular typing of methicillin resistance Staphylococcus aureus (MRSA) isolated from device related infections by SCCmec and PCR-RFLP of coagulase gene. Adv. Life Sci. 2018;6:34–40. [Google Scholar]
- Taj Y, Essa F, Aziz F, Kazmi SU. Study on biofilm-forming properties of clinical isolates of Staphylococcus aureus. J. Infect. Dev. Ctries. 2012;6:403–409. doi: 10.3855/jidc.1743. [DOI] [PubMed] [Google Scholar]
- Tiwari HK, Sapkota D, Gaur A, Mathuria JP, Singh A, Sen MR. Molecular typing of clinical Staphylococcus aureus isolates from northern India using coagulase gene PCR-RFLP. Southeast Asian J. Trop. Med. Public Health. 2008;39:467–473. [PubMed] [Google Scholar]
- Vasudevan P, Nair MKM, Annamalai T, Venkitanarayanan KS. Phenotypic and genotypic characterization of bovine mastitis isolates of Staphylo-coccus aureus for biofilm formation. Vet. Microbiol. 2003;92:179–185. doi: 10.1016/s0378-1135(02)00360-7. [DOI] [PubMed] [Google Scholar]
- Wada M, Lkhagvadorj E, Bian L, Wang C, Chiba Y, Nagata S, Shimizu T, Yamashiro Y, Asahara T, Nomoto K. Quantitative reverse transcription-PCR assay for the rapid detection of methicillin-resistant Staphylococcus aureus. J. Appl. Microbiol. 2010;108:779–788. doi: 10.1111/j.1365-2672.2009.04476.x. [DOI] [PubMed] [Google Scholar]
- Zimmerli W, Trampuz A, Ochsner PE. Prosthetic-joint infections. New Engl. J. Med. 2004;351:1645–1654. doi: 10.1056/NEJMra040181. [DOI] [PubMed] [Google Scholar]
- Zmantar T, Chaieb K, Makni H, Miladi H, Abdallah FB, Mahdouani K, Bakhrouf A. Detection by PCR of adhesins genes and slime production in clinical Staphylococcus aureus. J. Basic Microbiol. 2008;48:308–314. doi: 10.1002/jobm.200700289. [DOI] [PubMed] [Google Scholar]