Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
(A) NMR structure of the complex between the unimolecular parallel G-quadruplex RET of sequence d(GGGGCGGGGCGGGGCGGGGT) and colchicine. 3′- and 5′-end of the G-quadruplex are at the top and bottom, respectively. Details of the ligand binding are highlighted in (B). Adapted with permission from ref. [94], Copyright 2020 The Royal Society of Chemistry.
