Table 2. Sequence and position of the AHSV-1 DIVA primer and probes used in study of development of PCR to characterize affecting strain of AHSV, Thailand* .
Primer/probe | Sequence, 5′ → 3′ | Sense | Position |
---|---|---|---|
VP5-DIVA-F | 5′ AGCGTCGGATGCAAAGAAATC 3′ | + | 1335–1355 |
VP5-DIVA-P1 | 5′ FAM- ACTACAGCTGGTGCATAAC 3′ MGB | + | 1426–1444 |
VP5-DIVA-P2-vac | 5′ FAM- TTTACAGTTGGTTCATAAT 3′ MGB | + | 1426–1444 |
VP5-DIVA-R | 5′ AAGCGCGTTCATTATCGTCC 3′ | – | 1494–1513 |
*Position numbering is with reference to AHSV-1 (GenBank accession no. KT030334). AHSV, African horse sickness virus; DIVA, Differentiating Infected from Vaccinated Animals.