Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
External (ext) and internal (int) primers used for the nested PCR.
| Primer |
Sequence (5’ ➔ 3’) |
Length (bp) |
GC content (%) |
Melting temperature (°C) |
|---|---|---|---|---|
| Ev_ext_fw | ACAGTGCAAGGCTGTGCAGAACT | 23 | 52.1 | 69.4 |
| Ev_ext_rv | ACATCAGTGAGTCTGTGGCTTGGA | 24 | 50 | 69.2 |
| Ev_int_fw | CAAACAAACAACTGCATCACCA | 22 | 40.9 | 65.7 |
| Ev_int_rv | TGGAAAAGCTCTGCAATAGTGT | 22 | 40.9 | 62.6 |
