REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
goat-anti-PECAM	R&D systems	Cat# AF3628; RRID: AB_2161028
rabbit anti-CD31	Abcam	Cat# ab28364; RRID: AB_726362
rabbit anti-PDGFRβ	Abcam	Cat# ab69506; RRID: AB_1269704
goat anti-PDGFRβ	R&D systems	Cat# AF1042; RRID: AB_2162633
goat anti-PDGFRα	R&D systems	Cat# AF1062; RRID: AB_2236897
rabbit anti-Fibronectin	Abcam	Cat# ab268020
rabbit anti-Smad3 (phospho S423+S425)	Abcam	Cat# ab52903; RRID: AB_882596
goat anti-KLF4	R&D systems	Cat# AF3158; RRID: AB_2130245
rabbit anti-desmin	Abcam	Cat# ab15200; RRID: AB_301744
isolectin B4	Vector Laboratories	Cat# DL-1207; RRID: AB_2336415
rat anti-PDGFRβ-biotin	Thermo Fisher Scientific	Cat# 14-1402-82; RRID: AB_467493
rabbit anti-Fibrinogen	ABclonal	Cat# A19685
rabbit anti-CD41	ABclonal	Cat# A11490; RRID: AB_2861582
Bacterial and virus strains
pCDH-CMV-MCS-EF1-Puro	Provided by Dr. Yupeng Cheng (Tianjin Medical University, China)	N/A
short hairpin RNAs of CCM1	Provided by Dr. Yuzheng Zhang (Shanghai East Hospital, Tongji University School of Medicine, China)	N/A
non-specific short hairpin RNAs	Provided by Dr. Yuzheng Zhang (Shanghai East Hospital, Tongji University School of Medicine, China)	N/A
Biological samples
Human brain CCM tissues	First Affiliated Hospital of Harbin Medical University	N/A
Human brain epilepsy tissues	First Affiliated Hospital of Harbin Medical University	N/A
Chemicals, peptides, and recombinant proteins
CP-673451	Selleck	Cat# S1536
RGDS peptide	MCE	Cat# HY-12290
Human TGF-β1	Absin	Cat# abs04204
Deposited data
Raw and analyzed data	This paper	GEO: GSE213244
Experimental models: Cell lines
Human umbilical vein endothelial cells	Provided by Dr. Xiaohong Wang (Tianjin Medical University, China)	N/A
Human brain vascular pericytes	ScienCell	Cat# 1200
Experimental models: Organisms/strains
Cdh5CreERT2/+	Dr. Xiangjian Zheng, Tianjin Medical University	N/A
Ccm1fl/fl	Dr. Xiangjian Zheng, Tianjin Medical University	N/A
Oligonucleotides
FN1 Forward: GTCCCCTGGGGTCACCTAT	Tsingke Biotechnology Co., Ltd.	N/A
FN1 Reverse: TCCTGTTATCTGGGCCCGA	Tsingke Biotechnology Co., Ltd.	N/A
Fn1 Forward: TTGAGAACCTGAATCCTGGCC	Tsingke Biotechnology Co., Ltd.	N/A
Fn1 Reverse: TATTCTGTCCCAGGCAGGAGA	Tsingke Biotechnology Co., Ltd.	N/A
Klf4 Forward: GTGCCCCGACTAACCGTTG	Tsingke Biotechnology Co., Ltd.	N/A
Klf4 Reverse: GTCGTTGAACTCCTCGGTCT.	Tsingke Biotechnology Co., Ltd.	N/A
Recombinant DNA
pCDH-CMV-MCS-SMAD3-EF1-Puro	This paper	N/A
short hairpin RNAs of CCM1	This paper	N/A
non-specific short hairpin RNAs	This paper	N/A
Software and algorithms
Image J	ImageJ Software	https://imagej.nih.gov/ij/download.html
GraphPad Prism 8.0.2	GraphPad	https://www.graphpad.com/scientific-software/
SPSS 20.0	IBM Co.	https://www.ibm.com