| Gene symbol | Description | GenBank | Size (bp) | Primer sequence 5′ → 3′ S/AS |
|---|---|---|---|---|
| Synj2bp | Mus musculus Synaptojanin 2 binding protein (Synj2bp), 2 coding RNA transcripts | NM_025292/NM_001309814 | 130 | TCGGTGGGACAGATCAACAGTA/TGGCCATTTACCGAGAGGATC |
| Atp5o | Mus musculus ATP synthase, H + transporting, mitochondrial F1 complex, O subunit (Atp5o) | NM_138597 | 142 | GCTATGCAACCGCCCTGTACTCTG/ACGGTGCGCTTGATGTAGGGATTC |
| Hprt1 | Mus musculus hypoxanthine guanine phosphoribosyl transferase 1 (Hprt1) | NM_013556 | 106 | CAGGACTGAAAGACTTGCTCGAGAT/CAGCAGGTCAGCAAAGAACTTATAGC |
| Gapdh | Mus musculus glyceraldehyde-3-phosphate dehydrogenase (Gapdh) | NM_008084 | 194 | GGCTGCCCAGAACATCATCCCT/ATGCCTGCTTCACCACCTTCTTG |
| gDNA | Mus musculus chromosome 3 genomic contig, strain C57BL/6 J (Hsd3b1 intron) | NT_039239 | 209 | CACCCCTTAAGAGACCCATGTT/CCCTGCAGAGACCTTAGAAAAC |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.