| Gene promoter | Forward (5′- 3′) | Reverse (5′- 3′) |
|---|---|---|
| AMY2B #1 | tcagcactggattgtagaacttg | aagccacatgtactaaagactgaaa |
| AMY2B #2 | aacctcaaggccaacagaga | tgcaaccacaggtgtagagg |
| CXCL10 #1 | tggattgcaacctttgttttt | tttccctctgctcctcttttt |
| CXCL10 #2 | gccacgattcatcatccagt | gggttcagctccaagacact |
| IFIT2 #1 | ctccggaggaaaaagagtcc | tcccttcagctgacgttaca |
| IFIT2 #2 | aagagcattttggggtgaaa | accccacttcctgctaaggt |
| ISG15 #1 | gtttcttccgctcactctgg | ataagcctgaggcacacacg |
| ISG15 #2 | catggggatgttttccaagt | taaatatcgcgcattccaga |
| MX1 #1 | ccgagaacctgcgtctcc | actcacagaccctgtgctga |
| MX1 #2 | ggcctggcctgacaactat | aacgggtgtgtggaagga |
| OASL #1 | ctgggcaacagagcaagac | cctgtgccagactctaacctc |
| OASL #2 | ctgggcgagacagtgagact | gtgatttcagccagcgttta |
| TFAM proximal | cgaccggatgttagcagatt | ggcaatacacaactccagca |
| TFAM distal | tggaaggtccctttcaacc | tgaaaacattggctctctgg |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.