TABLE 3.
Primers used for cloning the intragenic fragments of orfde4 and orfde6
| Primer | Length | Sequencea | 5′ Nucleotide position in corresponding ORF |
|---|---|---|---|
| GW345 | 26-mer | ATAGGATCCATTTATTACTATCCATC | 165 of orfde4 |
| GW346 | 22-mer | ATGGGATCCACCGTTTCAAAAG | 671 of orfde4, complementary strand |
| GW347 | 24-mer | AGAGGATCCACCACGTTTTGAAAG | 165 of orfde6 |
| GW348 | 24-mer | TAAGGATCCGTGTGTGCCTGTATC | 667 of orfde6, complementary strand |
a
Underlined letters indicate BamHI site; bold letters indicate sequences from orfde4 or orfde6. Sequences run from the 5′ end to the 3′ end.