| Gene | Forward primer | Reverse primer | Product length (bp) |
|---|---|---|---|
| 18 S | gtggagcgatttgtctggtt | cgctgagccagtcagtgtag | 200 |
| β‐actin | gacaggatgcagaaggagat | ttgctgatccacatctgctg | 146 |
| Dll4 | tttgcccagactccatcctcacag | ttccccccatctcccttattgg | 356 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.