FIG. 14.

Single-mutation analysis of pLZ9R8 site 2. (A) Gel mobility shift. The assay was carried out with 0, 1, 10, or 50 ng, as described in Materials and Methods. NC, a 26-bp negative control DNA from nonfootprinting sequence of pLZ9R8 (CATTACTGATGATGTTTGTATCATTC); WT, wild-type 26-bp LZ9R8 site 2 (see panel B); P1 to P15, single-base-pair mutations, as indicated in panel B. Arrows indicate the positions of DNA-protein complexes. (B) Summary of the results of single-mutation analysis. The number of plus signs reflects the relative strength of the shift, with +++ being equivalent to wild type.