Appendix 1—key resources table.
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Strain, strain background (Escherichia coli) | One Shot Stbl3 Chemically Competent E. coli | Life Technologies | C7373-03 | |
Strain, strain background (Escherichia coli) | BL21 (DE3) | Life Technologies | C600003 | |
Strain, strain background (Escherichia coli) | MAX Efficiency DH10Bac Competent Cells | Thermo Fisher | 10361012 | |
Cell line (Homo-sapiens) |
293 FT | Invitrogen | R70007 | |
Cell line (Homo-sapiens) |
FreeStyle 293 F | Invitrogen | R79007 | |
Cell line (Homo-sapiens) |
HEK293S GnTI- | ATCC | CRL-3022 | |
Cell line (Homo-sapiens) |
HeLa Tet-on | Takara Bio | 631183 | |
Cell line (Spdoptera frugiperda) |
Sf9 | ATCC | CRL-1711 | |
Transfected construct (Homo-sapiens) | pET-28a-His6-SUMO-IGF1 | This paper | Protein expressing and purification: Mature human IGF1 gene (residues 49–118) was subcloned into modified pET-28a vector encoding a His6-tag and SUMO-tag at N-terminus. | |
Transfected construct (Mus musculus) | pEZT-BM-mouse IGF1R-P673G4 | This paper | Protein expressing and purification: NM_010513.2 with C-terminal tail truncation (residues 1–1262), D1107N, Y951A, and four glycine insertion between P673 and K674 |
|
Transfected construct (Mus musculus) | pEZT-BM-mouse insulin receptor (IR)–3CS | This paper | Protein expressing and purification: NM_010568.3 with D1122N, Y962F, C684S, C685S, and C687S |
|
Transfected construct (Homo-sapiens) | pCS2-human IR WT-MYC | Choi et al., 2016, Cell | ||
Transfected construct (Homo-sapiens) | pCS2-human IR-3CS-MYC | This paper | Cysteine mutation (C682S, C683S, C685S) | |
Transfected construct (Homo-sapiens) | pCS2-human IR Δ686–690-MYC | This paper | Deletion residues 686–690 | |
Transfected construct (Homo-sapiens) | pCS2-human IR Δ170–181-MYC | This paper | Deletion residues 170–181 | |
Transfected construct (Homo-sapiens) | pCS2-human IGF1R WT-MYC | Li et al., 2019, Nature Communications | ||
Transfected construct (Homo-sapiens) | pCS2-human IGF1R P673G4-MYC | This paper | Four glycine insertion between P673 and K674 | |
Transfected construct (Homo-sapiens) | pCS2-human IGF1R Δ3C-MYC | This paper | Deletion residues 669–572 | |
Transfected construct (Homo-sapiens) | pBabe-puro-IR WT-GFP | Choi et al., 2016, Cell | ||
Transfected construct (Homo-sapiens) | pBabe-puro-IR 3CS-GFP | This paper | Cysteine mutation (C682S, C683S, C685S) | |
Transfected construct (Homo-sapiens) | pBabe-puro-IR Δ686–690-GFP | This paper | Deletion residues 686–690 | |
Transfected construct (Homo-sapiens) | pBabe-puro-IGF1R WT-GFP | This paper | Mature human IGF1R | |
Transfected construct (Homo-sapiens) | pBabe-puro-IGF1R P673G4 | This paper | Four glycine insertion between P673 and K674 | |
Antibody | Anti-IR-pY1150/1151 (Rabbit monoclonal, 19H7) |
Cell Signaling | #3024 | WB (1:1000) |
Antibody | Anti-AKT (Mouse monoclonal, 40D4) | Cell Signaling | #2920 | WB (1:1000) |
Antibody | Anti-pS473 AKT (Rabbit monoclonal, D9E) | Cell Signaling | #4060 | WB (1:1000) |
Antibody | Anti-ERK1/2 (Mouse monoclonal, L34F12) | Cell Signaling | #4696 | WB (1:1000) |
Antibody | Anti-pERK1/2 (Rabbit monoclonal, 197G2) | Cell Signaling | #4377 | WB (1:1000) |
Antibody | Anti-Myc (Mouse monoclonal, 9E10) |
Roche | #11667149001 | WB (1:1000) |
Antibody | Anti-GFP (Rabbit polyclonal) |
Homemade (Xia et al., 2004; Tang et al., 2001) |
IFA (1:500) | |
Antibody | Anti-rabbit immunoglobulin G (IgG) (H+L) Dylight 800 conjugates (secondary antibody) | Cell Signaling | #5151 | WB (1:5000) |
Antibody | Anti-mouse IgG (H+L) Dylight 680 conjugates (secondary antibody) | Cell Signaling | #5470 | WB (1:5000) |
Recombinant DNA reagent | p-gag/pol | Addgene | #14887 | Retrovirus production |
Recombinant DNA reagent | pCMV-VSV-G | Addgene | #8454 | Retrovirus production |
Sequence-based reagent | PCR primers site-directed mutagenesis for human IR 3CS | This paper |
F:tcctctCCAAAGACAGACTCTCAGATCCTG R:ggaggaTTCGCCGGCCGAATCCTC |
|
Sequence-based reagent | PCR primers site-directed mutagenesis for human IR Δ686–690 | This paper |
F:CAGATCCTGAAGGAGCTGG R:ACAGGAGCAGCATTCGCC |
|
Sequence-based reagent | PCR primers site-directed mutagenesis for human IR Δ170–181 | This paper |
F:TGTTGGACTCATAGTCACTG R:GCAGTTGGTCTTGCCCTT |
|
Sequence-based reagent | PCR primers site-directed mutagenesis for human IGF1R P673G4 | This paper |
F:ggaggtAAAACTGAAGCCGAGAAGCAGGCC R:acctccGGGGCAGGCGCAGCAAGG |
|
Sequence-based reagent | PCR primers site-directed mutagenesis for human IGF1R Δ3C | This paper |
F:CCCAAAACTGAAGCCGAGAAG R:AGGCCCTTTCTCCCCACC |
|
Sequence-based reagent | PCR primers site-directed mutagenesis for mouse IGF1R P673G4 | This paper |
F:CTGCGCTTGCCCTGGCGGAGGAGG CAAAACTGAAGCTGAGAAGCAGG R:GCTTCAGTTTTGCCTCCT CCGCCAGGGCAAGCGCAGCAT |
|
Sequence-based reagent | PCR primers site-directed mutagenesis for mouse IR-3CS | This paper |
F:TCATCTCCTAAGACTGACTCTCAGATCC R:GGATGACTCACTGGCCGAGTCGTC |
|
Peptide, recombinant protein | Human Insulin | Sigma | I2643 | |
Peptide, recombinant protein | Human IGF1 | PeproTech | 100–11 | |
Commercial assay or kit | Micro BCA Protein Assay Kit | Thermo Scientific | 23235 | |
Commercial assay or kit | Alexa Fluor 488 | Thermo Scientific | A10235 | |
Commercial assay or kit | Q5 site directed mutagenesis kit | NEB | E0554S | |
Commercial assay or kit | Gibson Assembly Master Mix | NEB | E2166L | |
Chemical compound, drug | cOmplete Protease Inhibitor Cocktail | Roche | 05056489001 | |
Chemical compound, drug | PhosSTOP | Roche | 4906837001 | |
Chemical compound, drug | BMS536924 | Tocris | 4774 | |
Chemical compound, drug | Cellfectin | Invitrogen | 10362100 | |
Chemical compound, drug | Lipofectamine 2000 | Invitrogen | 11668019 | |
Software, algorithm | Prism 9.0d | GraphPad | N/A | Statistics |
Other | Pierce Anti-c-Myc Magnetic Beads | Thermo Scientific | 88843 | In vitro insulin binding assay |
Other | ProLong Gold Antifade reagent with DAPI | Invitrogen | P36935 | Immunofluorescence assay for IR and IGF1R trafficking |