A unique DNA fragment of Coxiella burnetii was verified by Sanger sequencing in the resected tissue sample of Patient No. 5 (A). A unique DNA fragment of Coxiella burnetii was verified by Sanger sequencing in the resected tissue sample of Patient No. 5 (A). The PCR primers of Coxiella burnetii for verification were TAACGCAAGGCGGTGATTTAG and CGATAGGGACGATGGTGGAA. The sequence ID of the target species was CP040059.1, and the location of the target sequence was 1: 214,444 to 214,577. A unique DNA fragment of Bartonella species was verified by Sanger sequencing in the resected tissue sample of Patient No. 4 (B). The PCR primers of Bartonella species for verification were TGGTGGTCAGCGTTTTGGT and CCTCAAATGTATCGTCACCGC. The sequence ID of the target species was AP019773.1, and the location of the target sequence was 1: 687,822 to 687,945. The colored curves represented different basic group such as green for adenine, red for thymine, black for guanine and blue for cytosine.