KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit monoclonal p-AKT (Ser473) (D9E) | Cell Signaling | 4060; RRID:AB_2315049 |
| Rabbit monoclonal pan AKT (C67E7) | Cell Signaling | 4691; RRID:AB_915783 |
| Rabbit polyclonal adiponectin | GeneTex | GTX112777; RRID:AB_2885323 |
| Mouse monoclonal Beta actin (AC-15) | Sigma-Aldrich | A5441; RRID:AB_476744 |
| Rabbit polyclonal HSP90 | GeneTex | GTX110089; RRID:AB_1950529 |
| Armenian hamster monoclonal CD11c (N418) | ThermoFisher | 12-0114-82; RRID:AB_465552 |
| Rat monoclonal CD206 (MR5D3) | Bio-Rad | MCA2235F; RRID:AB_324594 |
| Rat monoclonal CD45 (30-F11) | ThermoFisher | 17-0451-82; RRID:AB_469392 |
| Rat monoclonal F4/80 (BM8) | ThermoFisher | 45-4801-82; RRID:AB_914345 |
| Rabbit polyclonal p-HSL (Ser563) | Cell Signaling | 4139; RRID:AB_2135495 |
| Rabbit polyclonal total HSL | Cell Signaling | 4107; RRID:AB_2296900 |
| Rat monoclonal Galectin-3 (MAC2) (M3/38) | eBioscience | 13-5301-82; RRID:AB_837113 |
| Rat monoclonal Galectin-3 (MAC2) (M3/38) | Novus Biologicals | NBP1-43313; RRID:AB_10006681 |
| Rabbit monoclonal GAPDH (14C10) | Cell Signaling | 2118; RRID:AB_561053 |
| Guinea pig Perilipin 1 | Progen | GP-29; RRID:AB_2892611 |
| Rabbit polyclonal Tyrosine hydroxylase | Pel-Freez Biologicals | P40101-150; RRID:AB_2617184 |
| Rabbit monoclonal pSTAT3 (Tyr705) (D3A7) | Cell Signaling | 9145; RRID:AB_2491009 |
| Mouse monoclonal CD68 (KP1) | Invitrogen | MA5-13324; RRID:AB_10987212 |
| Donkey anti-mouse IgG Alexa Fluor 488 | Jackson ImmunoResearch Labs | 715-545-151; RRID:AB_2341099 |
| Goat anti-rabbit IgG Alexa Fluor 488 | ThermoFisher | A-11034; RRID:AB_2576217 |
| Donkey anti-rat Alexa Fluor 647 | Jackson ImmunoResearch Labs | 712-606-153; RRID:AB_2340696 |
| Donkey anti-guinea pig IgG Alexa Fluor 647 | Jackson ImmunoResearch Labs | 706-605-148; RRID:AB_2340476 |
| IRDye 800CW donkey anti-rabbit IgG | Li-Cor | 925-32213; RRID AB_2715510 |
| IRDye 680RD donkey anti-mouse IgG | Li-Cor | 925-68072; RRID AB_2814912 |
| Bacterial and virus strains | ||
| Biological samples | ||
| Human subcutaneous preadipocytes | Zen-Bio Inc. | #SL0065 |
| Chemicals, peptides, and recombinant proteins | ||
| Auranofin | Sigma-Aldrich | A6733 |
| Tamoxifen | MP Biomedicals | 156738 |
| T-PER Tissue Protein Extraction Reagent | ThermoFisher | 78510 |
| Halt Protease and Phosphatase Inhibitor Cocktail | ThermoFisher | 78440 |
| 4′,6-diamidino-2-phenylindole (DAPI) | Sigma-Aldrich | D8417 |
| MitoTracker Red CMX-ROS | ThermoFisher | M7512 |
| LipidTOX | Life Technologies | H34475 |
| DAPI Fluoromount-G | VWR | 0100-20 |
| IRDye 680RD Streptavidin | LI-COR | 926-68079 |
| Tissue-Tek OCT compound | Sakura Finetek | 4583 |
| Formaldehyde | ThermoFisher | 28908 |
| Collagenase type I | Worthington Biochemical Corp | LS004194 |
| Collagenase type I | Roche | 17100-017 |
| Dispase II | Sigma-Aldrich | D4693 |
| Isobutylmethylxanthine (IBMX) | Sigma-Aldrich | 13347 |
| Rosiglitazone | Cayman Chemical Co | 71740 |
| Dexamethasone | Tocris Biosciences | 1126 |
| Insulin | Sigma-Aldrich | I5500 |
| 3,3′,5-Triiodo-L-thyronine (T3) | Sigma-Aldrich | T-074 |
| DMSO | Sigma-Aldrich | D2660 |
| Polyethylene glycol 400 | Affymetrix | 19957 |
| Ethanol absolute 200 proof | Fisher Scientific | BP2818 |
| 10% Neutral buffered formalin | Fisher Chemical | SF100-4 |
| DMEM/F-12, GlutaMAX | ThermoFisher | 10565-018 |
| Fetal Bovine Serum | VWR | 97068-085 |
| Penicillin-Streptomycin | Gibco | 15140-122 |
| Sodium pyruvate | Gibco | 11360-070 |
| L-glutamine | Gibco | 25030-081 |
| Seahorse XF assay medium modified DMEM | Agilent | 102365-100 |
| Isoproterenol | Cayman Chemical | 15592 |
| 2-deoxy-D-glucose, [1-14C] | PerkinElmer | NEC720A050UC |
| Glucose, D-[2-3H] | PerkinElmer | NET238C001MC |
| Critical commercial assays | ||
| Rat/Mouse Insulin ELISA | Millipore | EZRMI-13K |
| Mouse Leptin ELISA kit | Crystal Chem | 90030 |
| Adiponectin Mouse ELISA Kit | ThermoFisher | KMP0041 |
| DPPIV (DPP4/CD26) Mouse ELISA Kit | ThermoFisher | EMDPP4 |
| Proteome Profiler Mouse Adipokine Array Kit | R&D Systems | ARY013 |
| Triglycerides Reagent | ThermoFisher | TR22421 |
| Glycerol Assay kit | Sigma-Aldrich | MAK117 |
| Serum/Plasma Fatty Acid Detection Kit | Zen-Bio Inc. | sfa-1 |
| Deposited data | ||
| RNA-seq data | This paper | GEO: GSE202935 |
| Experimental models: Cell lines | ||
| Experimental models: Organisms/strains | ||
| Mouse: C57/Bl6J | BCM Center for Comparative Medicine | N/A |
| Mouse: FVB | BCM Center for Comparative Medicine | N/A |
| Mouse: Ubc-CreERT2;LepR-lp/lp | Cox et al. 2016 | N/A |
| Mouse: B6.Cg-Lepob/J | Jackson Laboratory | 000632; RRID:IMSR_JAX:000632 |
| Beta-less (bAR1, bAR2, bAR3 knockout mice) | Bachmann et al. 2002; Xu et al. 2014 | N/A |
| miR-30a −/− | This paper | N/A |
| Oligonucleotides | ||
| Primers for qPCR, see Table S2 | This paper | N/A |
| sgRNA sequence: miR-30a upstream ACTCCCGCAGAGCACTTCTCAGG | This paper | N/A |
| sgRNA sequence: miR-30a downstream TCAAGGAGTAATTATCTTGTTGG | This paper | N/A |
| Primer: miR-30a forward GCATCGAGGCTTTGCAGTTT | This paper | N/A |
| Primer: miR-30a reverse TGCACAGGAAGAACACTTCTGT | This paper | N/A |
| Recombinant DNA | ||
| Software and algorithms | ||
| Fiji | Schindelin et. al. 2012 | https://imagej.net/software/fiji/ |
| ImageJ with Adiposoft plugin | CIMA, University of Navarra | https://imagej.net/plugins/adiposoft |
| Prism 9 | GraphPad | https://www.graphpad.com/ |
| CalR | Palmer et al. 2017 | https://calrapp.org/ |
| STAR | Dobin et al., 2013 | https://github.com/alexdobin/STAR |
| DESeq2 | Love et al., 2014 | https://github.com/mikelove/DESeq2 |
| GSEA | Subramanian et al., 2005 | https://www.gsea-msigdb.org/gsea/index.jsp |
| GenePix Pro 7.0 Microarray Acquisition & Analysis Software | Molecular Devices | https://www.moleculardevices.com |
| Other | ||
| 4-12% Bis-Tris NuPage gels | Life Technologies | NP0321Box |
| Immobilon-P Transfer Membranes | Millipore | IPVH00010 |
| Direct-zol RNA MiniPrep kit | Zymo Research | R2051 |
| qScript | QuantBio | 95048-100 |
| Sso-Advanced Universal Probes Supermix | Bio-Rad | 175284 |
| TaqMan Advanced miRNA cDNA Synthesis | ThermoFisher | A28007 |
| TaqMan Advanced miRNA Assays | ThermoFisher | A25576 |
| TaqMan Gene Expression Assays (FAM) | ThermoFisher | 4331182 |
| NEBNext Ultra II DNA library prep kit | New England Biolabs | E7645S |
| Seahorse XF24 Islet Capture FluxPak | Agilent | 103518-100 |
| Seahorse XF24 FluxPak | Agilent | 102342-100 |
| Seahorse XF24 V7-PS cell culture microplates | Agilent | 100777-004 |
| Seahorse XF Cell Mito Stress Test Kit | Agilent | 103010-100 |
| 60% high fat diet | Bio-Serv | S3282 |
| Precision Count Beads | BioLegend | 424902 |