TABLE 1.

Oligonucleotide probe and primer sequences^a

Oligonucleotide probe designation	Oligonucleotide sequence (5′ to 3′)	Probe binding site
bdrABF1	AAGGAGATTTTTATGGGAC	Bases −12 to +7 of bdrA and bdrB alleles
bdrA1R1	CTCATAGCTCATAGATGC	Bases 637 to 654 of bdrA1; binds to the 3′ end of other bdrA alleles
bdrAsfR1	GTTATCAAGTTCGGTTTTAACAG	Bases 201 to 225 of bdrA alleles
bdrBsfR1	GGTATCGAGTTCAGTTTTGAGAG	Bases 201 to 225 of bdrB alleles
BBG30hF2	GGCAATAATGATTATTATTGTG	Binds near the 3′ end of the pBt2.2 insert within the BBG30h gene
bdrAB-PCR	PCR-generated probe	12 bp upstream of the coding sequence of bdrA1 through base 654; obtained with the bdrABF1-bdrA1R1 primer set and pBt2.2 as template
BA60	TTTGATATCATGAAACCAGCACTACCAAATATTGC	Targets the 5′ end of the bdrF1 gene of B. afzelii
BA61	TCAGATATCTTTAAGGATTATTTGTAATTTCTATT	Targets the 3′ end of the bdrF1 gene of B. afzelii

^aThe F and R designations included in the primer names indicate that the primers target either the positive or negative strand of DNA of the bdr locus and are therefore forward or reverse primers, respectively. The underlined sequences in the BA60 and BA61 primers indicate the positions of the introduced EcoRV restriction sites that were incorporated for cloning purposes.