Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used in this study.
| Gene (bp) | Sense | Sequence (5′–3′) | Reference |
|---|---|---|---|
| f18 (450) | F18F | aactttaagaaggagatatacatatgcagcaaggggatgttaaa | This study |
| F18R | cagtggtggtggtggtggtgctcgagcttgtaagtaaccgcgtaagcc | This study | |
| F18fF | cgcggatccggtcagcaaggggatgttaaatt | This study |
Note: bold and underlined letters indicate restriction enzyme.
