Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Dec 14.
Published in final edited form as: Reprod Toxicol. 2022 Apr 11;110:113–123. doi: 10.1016/j.reprotox.2022.04.002

Phthalate monoesters act through peroxisome proliferator-activated receptors in the mouse ovary

Daryl D Meling a, Kathy M De La Torre a, Andres S Arango b,c, Andressa Gonsioroski a, Ashley RK Deviney a, Alison M Neff a, Mary J Laws a, Genoa R Warner a, Emad Tajkhorshid b,c, Jodi A Flaws a,*
PMCID: PMC9749796  NIHMSID: NIHMS1852364  PMID: 35421560

Abstract

Widespread use of phthalates as solvents and plasticizers leads to everyday human exposure. The mechanisms by which phthalate metabolites act as ovarian toxicants are not fully understood. Thus, this study tested the hypothesis that the phthalate metabolites monononyl phthalate (MNP), monoisononyl phthalate (MiNP), mono(2-ethylhexyl) phthalate (MEHP), monobenzyl phthalate (MBzP), monobutyl phthalate (MBP), monoisobutyl phthalate (MiBP), and monoethyl phthalate (MEP) act through peroxisome proliferator-activated receptors (PPARs) in mouse granulosa cells. Primary granulosa cells were isolated from CD-1 mice and cultured with vehicle control (dimethyl sulfoxide) or MNP, MiNP, MEHP, MBzP, MBP, MiBP, or MEP (0.4–400 μM) for 24 h. Following culture, qPCR was performed for known PPAR targets, Fabp4 and Cd36. Treatment with the phthalate metabolites led to significant changes in Fabp4 and Cd36 expression relative to control in dose-dependent or nonmonotonic fashion. Primary granulosa cell cultures were also transfected with a DNA plasmid containing luciferase expressed under the control of a consensus PPAR response element. MNP, MiNP, MEHP, and MBzP caused dose-dependent changes in expression of luciferase, indicating the presence of functional endogenous PPAR receptors in the granulosa cells that respond to phthalate metabolites. The effects of phthalate metabolites on PPAR target genes were inhibited in most of the cultures by co-treatment with the PPAR-γ inhibitor, T0070907, or with the PPAR-α inhibitor, GW6471. Collectively, these data suggest that some phthalate metabolites may act through endogenous PPAR nuclear receptors in the ovary and that the differing structures of the phthalates result in different levels of activity.

Keywords: Ovary, Granulosa cells, PPAR, Nuclear receptor, Phthalates, Toxicants

1. Introduction

Phthalates are high production volume chemicals (HPVC) used in the production of many items to which humans are exposed on a routine basis, such as personal care products, medications, and plastics [1]. Human exposures occur through inhalation, dermal contact, ingestion, and intravenous methods. Levels detected in human urine are in the ng/mL range from environmental exposures [2] and in the μg/mL range from more direct exposures, such as from medications or medical tubing [3]. The EPA reference dose for one phthalate known as di(2-ethylhexyl phthalate (DEHP) is 20 μg/kg/day, the range of estimated human daily exposure to DEHP is 3–30 μg/kg/day [4,5], and the estimated range of occupational exposure is 143–286 μg/kg/day [6]. The occupational level of another phthalate known as diisononyl phthalate (DiNP) is up to 26 μg/kg/day [7] and the range of daily exposure to DiNP for infants chewing on plastic toys is up to 260 μg/kg/day [8]. Most phthalates are diesters with linkages in the ortho position on a benzene ring. These parent compounds are readily metabolized to more toxic monoesters [9–13] by enzymes in the saliva and the gut [14]. This metabolism can also occur in the ovary [15].

The reproductive health of both men and women has been shown to be affected by exposure to phthalates [12,16–23]. As known endocrine disrupting chemicals (EDCs), phthalates have been associated with abnormal cyclicity and subfertility in women [2,24]. A primary mechanism for these effects of phthalates is through targeting of the ovary. Phthalates can act through several pathways in the ovary, which includes the peroxisome proliferator-activated (PPAR) signaling pathways. PPAR signaling occurs through a family of three nuclear receptor transcription factors: PPAR-γ, PPAR-α, and PPAR-δ [25]. All three isoforms are found in both the thecal cells and granulosa cells of ovarian follicles, however, PPAR-α is more prevalent in thecal cells, whereas PPAR-γ is more prevalent in the granulosa cells [26,27]. PPAR receptors are activated by endogenous fatty acid-derived ligands to help maintain normal hormone levels in the ovary [26]. PPAR-γ levels in granulosa cells are influenced by changes in cyclic hormone levels and play an important role in the regulation of folliculogenesis, gametogenesis, steroidogenesis, cell differentiation, and cholesterol metabolism [26, 27].

Various studies have investigated the interactions of phthalates with PPARs both in silico and in vitro. In general, the affinity and the resulting biological activity is stronger for phthalate monoester metabolites than for parent phthalate diesters. The potency of phthalate monoesters in assays with PPAR-γ or PPAR-α tends to increase as the length of the side chain increases [28,29]. The same trend has been shown in multiple in silico studies that correlate docking scores and in vitro affinities of phthalates to PPAR receptors [30]. Most studies of phthalate monoesters acting through PPAR receptors in granulosa cells have focused on mono (2-ethylhexyl) phthalate (MEHP) and have shown that MEHP activates PPAR-γ in granulosa cells, which leads to a disruption in estradiol synthesis [31]. However, a study of a wider range of the abilities of both high molecular weight (MW) and low MW phthalate monoesters to act through PPAR receptors in granulosa cells is required to understand the mechanisms of phthalate toxicity.

Based on human exposure data, women are exposed to mixtures of phthalates on a daily basis [32,33]. A mixture based on human exposure studies has been shown to affect ovarian folliculogenesis and steroidogenesis in animal studies [34]. In addition, the phthalate mixture has been shown to alter gene expression in ovarian follicles [35, 36]. Because of their impact on human health, the phthalate metabolites in the mixture are good candidates for a survey of phthalates with a range of shapes and sizes and their interactions with the PPAR pathways. The specific phthalate monoesters include monononyl phthalate (MNP), monoisononyl phthalate (MiNP), MEHP, monobenzyl phthalate (MBzP), monobutyl phthalate (MBP), monoisobutyl phthalate (MiBP), and monoethyl phthalate (MEP) (Fig. 1). The parent phthalate of MNP and MiNP is the diester “DiNP”, which is marketed as a mixture of many isomers; MNP and MiNP are two representative monoester metabolites. Thus, this study was designed to test the hypothesis that the size and shape of the phthalate side chain significantly impact activation of the PPAR pathway in the granulosa cell. To test this hypothesis, we assessed the expression of two genes regulated through the PPAR pathway, Fabp4 and Cd36, and we assessed the ability of endogenous PPAR receptors in the granulosa cell to respond to phthalate monoesters in a luminescence assay. Finally, we examined the effects of PPAR isoform-specific antagonists on the expression of the selected genes.

Fig. 1. Phthalate Monoesters Used in this Study.

Fig. 1.

Open in a new tab

Mouse granulosa cells were treated with monoisononyl phthalate (MiNP), (A); monononyl phthalate (MNP), (B); mono (2-ethylhexyl) phthalate (MEHP), (C); monobenzyl phthalate (MBzP), (D); monobutyl phthalate (MBP), (E); monoisobutyl phthalate (MiBP), (F); or monoethyl phthalate (MEP), (G).

2. Materials and methods

2.1. Chemicals

MEP (Cat. No. M542580), MBP (Cat. No. M525100), MiBP (Cat. No. M547700), MiNP (Cat. No. B185500), MNP (Cat. No. M567200, and MBzP (Cat. No. M524900) were purchased from Toronto Research Chemicals (North York, ON, Canada). MEHP (Cat. No. ALR-138 N) was purchased from AccuStandard (New Haven, CT). Concentrated stocks of 0.53 M for each phthalate were made by dissolving them in dimethyl sulfoxide (DMSO). These stocks were added to media at 0.75 μL/mL to obtain final concentrations of 400 μM for each phthalate. These concentrations were then serially diluted with media containing DMSO to obtain media with lower concentrations of each phthalate. The PPAR-γ activator rosiglitazone (Cat. No. A4304, ApexBio, Houston, TX), and the PPAR-α activator WY-14643 (Cat. No. A4305, ApexBio) were used at a final concentration of 20 μM in media after dilution from a concentrated DMSO stock.

The PPAR-γ inhibitor T0070907 (Cat. No. A4301, ApexBio) and the PPAR-α covalent inhibitor GW6471 (Cat. No. B7797, ApexBio) were used at a final concentration of 5 μM. When used, the inhibitor was incorporated into the concentrated phthalate/DMSO stock so that the final concentration of DMSO in the media remained 0.075%.

The concentrations of phthalates in this study ranged from 0.4 to 400 μM, which corresponds to approximately 0.1–100 μg/mL, as used in our previous studies [35,36]. Reports of urinary concentrations of individual phthalate monoesters in healthy individuals indicate that they are cumulatively in the 0.1–0.4 μg/mL range [36]. This “environmental exposure” is comparable to the low end of the range of concentration of 0.4 μM used in this study [37]. The 40 μM concentration used in this study can be considered an “occupational exposure” [5]. In addition, reports indicate plasma concentrations of phthalate monoesters in the 10–30 μg/mL range in people that have had medical procedures [3,38, 39], which is comparable to 40 μM used in this study. Concentrations of 100 μg/mL (approximately 400 μM) are above the reported range in humans, but they are similar to the highest levels of phthalates used in previous studies in our laboratory [35,36,40].

2.2. Animals

CD-1 female mice were obtained from Charles River Laboratories (Wilmington, MA) or generated from mice obtained from the same source. The mice were housed at the College of Veterinary Medicine Animal Facility at the University of Illinois at Urbana-Champaign. If animals were shipped, they were allowed to acclimate to the facility overnight. Animals were subjected to 12-h light-dark cycles and a temperature range of at 22 ± 1 °C was maintained. Water and food (Harlan Teklad 2918) were provided for ad libitum consumption. The Institutional Animal Use and Care Committee at the University of Illinois at Urbana-Champaign approved of and provided oversight for all aspects of animal acquisition, animal care, euthanasia, and tissue collection.

2.3. Granulosa cell culture

Cycling CD-1 female mice aged 32–42 days were euthanized and the ovaries from 5 to 10 mice were aseptically removed and placed in supplemented α-minimal essential media (α-MEM, Life Technologies, Grand Island, NY) pre-warmed to 37 °C. Granulosa cells were released from antral follicles by rupturing the follicles with a watchmaker’s forceps. Media were supplemented with the following (12.6% total, by volume): 1 × ITS (10 μg/mL insulin, 5.5 μg/mL transferrin, 5 ng/mL sodium selenite, Sigma-Aldrich, St. Louis, MO), 1 × antibiotic anti-mycotic (100 U/mL penicillin, 100 μg/mL streptomycin, 25 ng/mL amphotericin B (Sigma-Aldrich), 10% FBS (Atlanta Biologicals), and 5 IU/mL FSH (Dr. A.F. Parlow). Cells were passed through a 23 G needle 3–4 times and then through a 40 μM cell strainer. Cells were then plated in a 20 mm culture dish and expanded 3–4 days in an incubator at 37 °C with 5% CO2 and controlled humidity. Cells were then released by treatment with 0.25% trypsin-ethylenediaminetetraacetic acid (EDTA) (Thermo Fisher Scientific, Cat. No. 25200056) and replated. Cell density at plating was 1 × 105 cells/well for 12-well plates. For RNA expression experiments, 24-hour treatments with phthalate or agonist ± inhibitor were started when the cells reached approximately 70% confluency after at least 48 h. An initial 2-hour pre-treatment was conducted with supplemented media containing inhibitor or DMSO only.

2.4. Gene expression analysis

Total RNA was isolated from snap-frozen granulosa cells using a MicroElute Total RNA Kit (Omega Bio-Tek, Norcross, GA) according to the manufacturer’s instructions. RNA was eluted in RNase-free water and the concentration was determined using a NanoDrop (λ = 260 nm, Nanodrop Technologies, Inc., Wilmington, DE). RNA (400 ng) was reverse-transcribed to complementary DNA (cDNA) using iScript Reverse Transcriptase (Bio-Rad Laboratories, Inc., Hercules, CA) according to the manufacturer’s protocol. Quantitative polymerase chain reaction (qPCR) analysis was done in 96-well plates in 10 μL reaction volumes containing 0.75 pmol/μL for each of two primers, cDNA derived from 6.67 ng total RNA, and 1 × SsoFast EvaGreen dye (Bio-Rad Laboratories). Quantifications were done using the CFX96 Real-Time Detection System (Bio-Rad Laboratories) and CFX Manager Software. All qPCR primers (Integrated DNA Technologies, Coralville, IA) were purchased lyophilized and dissolved in DNase-free water and are listed in Table 1. A mean value of duplicate runs was calculated for all samples. The qPCR protocol began with incubation at 95 °C for 5 min. This was followed by 40 cycles at 95 °C for 10 s, at 60 °C for 10 s, and at 72 °C for 10 s. Melting from 65 °C to 95 °C was followed by extension at 72 °C for 2 min. Melting temperature graphs, standard curves, and threshold cycle (Ct) values were acquired for each gene analyzed. The expression data were normalized to the corresponding values for 18 S ribosomal RNA (Rn18s). Individual relative fold changes were calculated by the 2−ΔΔCt method, then fold changes for each treatment were calculated compared to the control for the corresponding culture. DNA primers (listed 5′ to 3′) used for qPCR were purchased from Integrated DNA Technologies (Coralville, IA) had the following sequences: Rn18s (TCGGCGTCCCCCAACTTCTTA, GGTAGTAGCGACGGGCGGTGT), Fabp4 (CGCAGACGACAGGAAGGTGAA, GAAGTCACGCCTTTCATAACACAT), Cd36 (TTTCTTCTTCACAGCTGCCTTC, TGAAAGGATCAGCACTTCAAATC), Ppara (TGAACAAAGACGGGATG, TCAAACTTGGGTTCCATGAT), and Pparg (TGTGAGACCAACAGCCTGACGG, GTCCTGAATATCAGTGGTTCACCGC).

2.5. Luciferase expression assays

Granulosa cells were isolated as detailed above. After the cells were expanded for 48–72 h, the cells were transfected with the PPRE3X-TK-luc reporter plasmid (667 ng/mL) and the pNL1.1PGK (Promega) control plasmid (6.67 ng/mL) using Lipofectamine 3000 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Following overnight incubation, the cells were released with 0.25% trypsin-EDTA and replated at 1.5 × 104 cells/well in 150 μL in opaque clear-bottomed 96-well plates designed for light detection (Greiner Bio-One, Cat. No. 655098). After 48 h of incubation, supplemented media were exchanged for 150 μL of the same media ± phthalate or agonist. Control supplemented media contained 0.075% DMSO. Serial dilutions of phthalates (two-fold) were generated using supplemented media with DMSO. The resulting concentrations were: 400 μM, 200 μM, 100 μM, 50.0 μM, 25.0 μM, 12.5 μM, 6.25 μM, 3.13 μM, 1.56 μM, 0.781 μ M, and 0.391 μM. Samples were spaced to prevent signal detection of neighboring samples. Following 24 h of incubation with treatment media, the media were removed, and the cells were washed briefly with 40–50 μL Hank’s Balanced Salt Solution (Thermo Fisher Scientific, Cat. No. 14175095). Luciferase detection was performed using the Nano-Glo Dual Luciferase Reporter Assay System (Promega, Cat. No. E1910) by adding an equal volume of OneGlo Reagent. Resulting light emission from the firefly luciferase reporter was measured after a 10-minute incubation (including 3 min orbital shaking). Next, an equal volume of Stop & Glo Reagent was added and light emission from the constitutively expressed Renilla luciferase control was measured after a 10-minute incubation (including 3 min orbital shaking). The SpectraMax iD3 Plate Reader with SoftMaxPro 7.1 software was used for light detection. Light production from luciferase was normalized to light production from Renilla luciferase for each individual well. Treatment samples were then normalized to DMSO-only control on each plate.

2.6. Cytotoxicity assays

Granulosa cells were plated and replated at 1.5 × 104 cells/well as described previously in Section 2.5. For select dilutions of phthalates, treatment for 24 h was performed in 100 μL treatment media. Cytoxicity assays were performed using the Cytotox-Glo Cytotoxicity Assay (Promega, Cat. No. G9290). Addition of 50 μL assay buffer for detection of dead cells allowed luciferase light emission detection following 15 min incubation (including 3 min orbital shaking). Next, addition of 50 μL lysis buffer for detection of total cells allowed luciferase light emission detection following 15 min incubation (including 3 min orbital shaking). As before, the SpectraMax iD3 Plate Reader with SoftMaxPro 7.1 software was used for light detection. Data from each culture were normalized to readings from identical treatment media (same phthalate concentration) without cells that were treated with assay buffer and then lysis buffer.

2.7. Structural studies of PPAR nuclear receptors and phthalates

Molecular docking was performed using the Molecular Operating Environment (MOE) software (version 2019.01, Chemical Computing Group), utilizing the triangle matcher method for initial pose placement, with London dG scoring [41]. The receptor region used for the pose search was centered in the ligand binding domain with residues on the activation function region. This included residues on H3, H5, and H12, based on a selection of Y473, H323, and C285 for PPAR-γ, as well as Y464, Y314, and C276 for PPAR-α. Following pose estimation, an induced fit docking scheme was performed for pose refinement, allowing side chain and ligand relaxation, with a GBVI/WSA dG scoring [41]. The docked poses on PPAR-γ and PPAR-α were visualized and analyzed using Visual Molecular Dynamics (VMD) [42]. Structural models of PPAR-γ and PPAR-α were determined using AlphaFold [43].

2.8. Statistical analysis

All data were analyzed using GraphPad Prism software (GraphPad Software, San Diego, CA). Data were expressed as means ± standard error of the means (SEM) for 3–8 separate experiments in each treatment group. Multiple comparisons between normally distributed experimental groups were made using one-way analysis of variance (ANOVA) followed by Dunnett post hoc comparisons. If data were not normally distributed, comparisons between experimental and control groups were done using Mann-Whitney U tests. Statistical significance (*) was assigned for p ≤ 0.05. Borderline significance (^) was assigned for 0.05 < p ≤ 0.10.

3. Results

3.1. PPAR isoform abundance and the effects of PPAR agonists on selected genes

The relative expression of two PPAR isoforms, PPAR-α and PPAR-γ, was tested in granulosa cells from control cultures. The relative abundance of each isoform was significantly different in that after normalizing to the expression level of PPAR-α to 1-fold, the level of PPAR-γ was 12-fold higher than PPAR-α in the granulosa cells (Fig. 2A, n = 8).

Fig. 2. Expression Levels of PPAR Isoforms in Mouse Granulosa Cells.

Fig. 2.

Open in a new tab

Mouse granulosa cells were isolated and cultured with vehicle control (DMSO). DMSO-treated control cultures from several 24-hour treatments were compared for relative expression of PPAR isoforms- PPAR-α and PPAR-γ. All samples were normalized to the expression level of PPAR-α (A). Treatment was performed with 20 μM of selected PPAR agonists for 24 h- WY-14643 for PPAR-α activation and rosiglitazone for PPAR-γ activation. Fabp4 expression versus control was monitored following treatment with both agonists (B). Cd36 expression versus control was monitored following treatment with both agonists (C). The graphs indicate means ± SEMs from 3 to 6 separate cultures. * p ≤ 0.05.

The PPAR-α agonist WY-14643 did not increase the expression of Fabp4 (Fig. 2B), but it increased the expression of Cd36 by 2.4-fold versus control in cultured granulosa cells (Fig. 2C). The PPAR-γ agonist rosiglitazone increased the expression of Fabp4 by 132-fold and the expression of Cd36 by 38-fold versus control (Fig. 2B, C).

3.2. Cytotoxicity of phthalates

Control cultures treated with DMSO had an average percentage of dead cells of 4.0%. High MW phthalates were tested at concentrations of 50–400 μM. The high MW phthalates, MEHP and MBzP, did not cause an increase in the level of dead cells at any concentration (Fig. 3). The high MW phthalate MNP had a significantly higher level of dead cells, 6.7%, at 400 μM (Fig. 3) and the MiNP had a borderline significant higher level of dead cells, 14.5%, at 400 μM (Fig. 3).

Fig. 3. Cytotoxicity of Granulosa Cells in Response to Phthalate Exposure.

Fig. 3.

Open in a new tab

Mouse granulosa cells were isolated and cultured with vehicle control or varying doses (50–400 μM) of individual phthalates for 24 h. Percentage of cell death was monitored following treatment with MEHP, MBzP, MNP, and MiNP from 50 to 400 μM, and MBP, MiBP, and MEP at 400 μM only. The graphs indicate means ± SEMs from 3 to 6 separate cultures. * p ≤ 0.05; ^ 0.05 < p ≤ 0.10.

Low MW phthalates MBP, MiBP, and MEP were tested at 400 μM only. None of the low MW phthalates caused a significant increase in the rate of cell death (Fig. 3).

3.3. Expression of PPAR target genes in response to phthalate exposure

The high MW phthalate MEHP at 40 and 400 μM significantly increased expression of the PPAR target gene Fabp4 by 2.0-fold and 49-fold, respectively, compared to control (Fig. 4A). Similarly, MEHP at 40 and 400 μM significantly increased expression of another PPAR target gene Cd36 by 5.7-fold and 27-fold, respectively, compared to control (Fig. 4E). The phthalate MBzP affected the same downstream PPAR targets as MEHP, but to a different degree and direction than MEHP. Specifically, MBzP at 400 μM significantly increased expression by 9.1-fold and 16-fold compared to control for Fabp4 and Cd36, respectively (Fig. 4B, F).

Fig. 4. Expression of PPAR Target Genes in Response to High Molecular Weight Phthalate Exposure.

Fig. 4.

Open in a new tab

Mouse granulosa cells were isolated and cultured with vehicle control or varying doses (0.4–400 μM) of individual phthalates for 24 h. Gene expression of Fabp4 was monitored following treatment with MEHP (A), MBzP (B), MNP (C), and MiNP (D). Additionally, gene expression of Cd36 was also monitored in the same treatments with MEHP (E), MBzP (F), MNP (G), and MiNP (H). The graphs indicate means ± SEMs from 3 to 6 separate cultures. * p ≤ 0.05; ^ 0.05 < p ≤ 0.10.

The DiNP metabolites MNP and MiNP also caused changes in gene expression for the two selected PPAR target genes. Similar to MEHP and MBzP, MNP at 400 μM significantly increased expression of Fabp4 and Cd36 by 5.2-fold and 9.7-fold, respectively, compared to control (Fig. 4C, G). Interestingly, MiNP caused a nonmonotonic expression profile for both of the PPAR target genes. Specifically, MiNP at the two highest concentrations increased expression of Fabp4 by 6.1-fold and 1.5-fold, respectively, compared to control (Fig. 4D). MiNP at 40 and 400 μM also increased expression of Cd36 by 11-fold and 7.4-fold, respectively, compared to control (Fig. 4H).

Low MW phthalates MBP and MiBP, both with four-carbon side chains, also caused changes in the expression of both PPAR target genes. MBP slightly decreased expression of Fabp4 at 4 μM and increased expression of Fabp4 by 3.2-fold at 400 μM compared to control (Fig. 5A). MBP also increased expression of Cd36 at 400 μM by 6.8-fold compared to control (Fig. 5D). MiBP exposure caused different effects on PPAR target gene expression than MBP. Specifically, MiBP at 0.4 μM slightly decreased expression of Fabp4 compared to control (Fig. 5B).

Fig. 5. Expression of PPAR Target Genes in Response to Low Molecular Weight Phthalate Exposure.

Fig. 5.

Open in a new tab

Mouse granulosa cells were isolated and cultured with vehicle control or varying doses (0.4–400 μM) of individual phthalates for 24 h. Gene expression of Fabp4 was monitored following treatment with MBP (A), MiBP (B), and MEP (C). Additionally, gene expression of Cd36 was also monitored in the same treatments with MBP (D), MiBP (E), and MEP (F). The graphs indicate means ± SEMs from 3 to 6 separate cultures. * p ≤ 0.05; ^ 0.05 < p ≤ 0.10.

MEP, which has a 2-carbon sidechain, caused small changes in gene expression compared to control. Specifically, MEP at 40 μM slightly increased expression of Fabp4 (Fig. 5C), but did not cause changes in expression of Cd36 (Fig. 5F).

3.4. Granulosa cell endogenous PPAR activation in response to phthalate exposure

Normalized firefly luciferase activity was monitored in granulosa cell cultures. In this assay, increases in luciferase activity correlate with increases in PPAR activation. MBzP (50–100 μM) increased luciferase activity compared to control (Fig. 6). The peak increase of 5.3-fold was detected at 400 μM of MBzP compared to control and was the largest increase for this assay among all phthalates in the study. MNP also significantly increased luciferase activity at 6.3–100 μM compared to control. The peak increase of 4.3-fold was detected at 200 μM of MNP. Incubation with MiNP at 50–200 μM significantly increased luciferase activity compared to control. The peak increase of 2.1-fold was detected at 200 μM of MiNP, but reverted to a nonsignificant level of 0.9-fold at 400 μM of MiNP. MEHP (100–100 μM) significantly increased activity of luciferase compared to control, with the peak increase of 1.5-fold at 400 μM of MEHP. MBP, MiBP, and MEP did not cause significant changes in luciferase activity compared to control (Fig. 6).

Fig. 6. Granulosa Cell Endogenous PPAR Activation in Response to Phthalate Exposure.

Fig. 6.

Open in a new tab

Mouse granulosa cells were isolated and cultured with vehicle or the selected phthalates. Following transfection with a DNA plasmid, PPRE3X, containing a PPAR response element proximal to firefly luciferase, treatment was performed with 0–400 μM of individual phthalates for 24 h. Relative luminescence versus control is plotted for MBzP (A), MNP (B), MiNP (C), MEHP (D), MBP (E), MiBP (F), and MEP (G). Individual wells were normalized to constitutively expressed NanoLuc luciferase that was cotransfected. Positive controls 20 mM rosiglitazone (“Rosi”) and 20 mM WY-14643 (“WY”) are included on each graph. The graphs indicate means ± SEMs from 3 to 6 separate cultures. * p ≤ 0.05; ^ 0.05 < p ≤ 0.10.

3.5. The roles of PPAR-γ and PPAR-α in phthalate-mediated induction of PPAR target genes

The PPAR-γ agonist rosiglitazone significantly increased expression of Fabp4 in granulosa cells compared to control (Figs. 2B, 7A). Similarly, the phthalates MEHP, MBzP, MNP, MiNP, and MBP significantly increased expression of the PPAR target gene Fabp4 compared to control (Figs. 4, 5, 7A). The PPAR-α agonist WY-14643 significantly increased expression of the PPAR target gene Cd36 compared to control (Figs. 2C, 8A). Similarly, the phthalates MEHP, MBzP, MNP, MiNP, MBP, MiBP, and MEP significantly increased expression of Cd36 compared to control (Figs. 4, 5, 8A).

Fig. 7. The Role of PPAR-γ in Phthalate-Mediated Induction of Fabp4.

Fig. 7.

Open in a new tab

Mouse granulosa cells were isolated and cultured with vehicle, agonist, or phthalate monoester ± the PPAR-γ inhibitor, T0070907. A summary of Fabp4 expression following treatments with 20 μM of PPAR-γ agonist, rosiglitazone, (Fig. 2) or 400 μM of individual phthalates (Figs. 2, 4, and 5) for 24 h is shown (A). Cultures were treated simultaneously with agonist or 400 μM phthalate ± the addition of 5 μM of a known PPAR-γ inhibitor (+i), T0070907. Relative expression values represent averages of proportion of expression ± inhibitor added to each treatment group (B). Significance was determined by comparing the amount of relative expression versus control with inhibitor. The graphs indicate means ± SEMs from 3 to 6 separate cultures. * p ≤ 0.05; ^ 0.05 < p ≤ 0.10.

Fig. 8. The Role of PPAR-α in Phthalate-mediated Induction of Cd36.

Fig. 8.

Open in a new tab

Mouse granulosa cells were isolated and cultured with vehicle, agonist, or phthalate monoester ± the PPAR-α inhibitor, GW6471. A summary of Cd36 expression following treatments with 20 μM of PPAR-α agonist, WY-14643, (Fig. 2) or 400 μM of individual phthalates (Figs. 2, 4, and 5) for 24 h is shown (A). Cultures were treated simultaneously with agonist or 400 μM phthalate ± the addition of 5 μM of a known PPAR-α inhibitor (+i), GW6471. Relative expression values represent averages of proportion of expression ± inhibitor added to each treatment group (B). Significance was determined by comparing the amount of relative expression versus control with inhibitor. The graphs indicate means ± SEMs from 3 to 6 separate cultures. * p ≤ 0.05; ^ 0.05 < p ≤ 0.10.

When vehicle control treated granulosa cells were co-treated with a PPAR-γ antagonist, T0070907, the relative expression of Fabp4 was significantly less than the no inhibitor control group (Fig. 7B). This inhibitor binds irreversibly to a cysteine residue in the PPAR-γ ligand binding domain [44]. This level of relative expression then was used as a baseline to compare inhibition with other phthalates ± PPAR-γ inhibitor. All comparisons were normalized as an average of percentage of expression to the corresponding culture without inhibitor. Relative expression of Fabp4 was significantly reduced by addition of the PPAR-γ inhibitor to granulosa cell cultures containing the PPAR-γ agonist rosiglitazone (20 μM). Similarly, relative expression of Fabp4 was significantly reduced by addition of inhibitor to cultures containing 400 μM MEHP, MBzP, MiNP, or MBP compared to inhibition of vehicle control plus inhibitor. However, relative expression of Fabp4 was not significantly reduced by addition of PPAR-γ inhibitor to cultures containing 400 μM MNP, MiBP, or MEP compared to inhibition of vehicle control plus inhibitor.

When vehicle control treated granulosa cells were co-treated with a PPAR-α antagonist, GW6471, the relative expression of Cd36 was significantly less than the no inhibitor treatment group (Fig. 8B). This inhibitor binds in the PPAR-α ligand binding domain [45]. This level of relative expression then was used as a baseline to compare inhibition with other phthalates ± PPAR-α inhibitor. Relative expression of Cd36 was significantly reduced by addition of the PPAR-γ inhibitor to granulosa cell cultures containing the PPAR-γ agonist WY-14643 (20 μM). Similarly, relative expression of Cd36 was significantly reduced by addition of inhibitor to cultures containing 400 μM MBzP, MBP, MiBP, or MEP compared to inhibition of vehicle control plus inhibitor. However, relative expression of Cd36 was not significantly reduced by addition of PPAR-γ inhibitor to cultures containing 400 μM MEHP, MNP, or MiNP compared to inhibition of vehicle control plus inhibitor.

3.6. Docking of phthalate monoesters to PPAR nuclear receptors

In our molecular docking study of phthalate binding to PPAR nuclear receptors, we centered our search to the ligand binding domain (LBD). Based on our docking of the LBD, we observed poses with binding of the phthalate carboxy groups to residues in Helix 12 (H12) for both of the PPAR isoforms (Fig. 9). In the case of PPAR-γ, we observed a decrease in phthalate carboxy to Y473 (H12) distance for both MBzP and MEHP (Fig. 9A & B). The MEHP carboxy group distance to the H12 tyrosine was observed to be 2.58 Å and 2.87 Å for PPAR-γ and PPAR-α, respectively, while distances for the MBzP carboxy to the H12 tyrosine were 2.78 Å and 2.90 Å for PPAR-γ and PPAR-α, respectively. This difference is likely due to a salt-bridge formation between H323 and the phthalate carboxy group, encouraging Y473 coordination to the carboxy group, thus facilitating an active H12 conformation. This is further enhanced by aromatic and hydrophobic stabilization from F363. Alternatively, in the case of PPAR-ɑ, the phthalate carboxy groups are stabilized through hydrogen bonding to Y464 and Y314 (Fig. 9C & D), with additional contribution to binding by I354. Additional hydrophobic stabilization of the phthalate side chains is provided by aliphatic side chains, I325/I317 and L330/L321 in PPAR-γ/PPAR-α.

Fig. 9. Predicted Docking poses of Phthalate Monoesters in PPAR Nuclear Receptors.

Fig. 9.

Open in a new tab

Selected phthalates from this study were docked to ligand binding domains of PPAR nuclear receptors. Shown here are MEHP docked to PPAR-γ (A) and PPAR-α (B), and MBzP docked to PPAR-γ (C), and PPAR-α (D). Key binding residues directly interacting with the ligands in the binding pockets of PPAR-γ(PPAR-α) include Y473(Y464) on Helix 12 (H12), H323(Y314), I326(I317), and L330(L321) on H5, C285 (C276) and I281(F272) on H3, and F363(I354) on H7.

4. Discussion

In this study, we tested seven different phthalate monoesters, which are primary phthalate metabolites commonly found in humans. The main goal of this study was to determine how different phthalate monoesters activate the PPAR pathway in granulosa cells taken from healthy ovaries and to learn more about which PPAR isoforms interact with which phthalates. The seven selected phthalate monoesters were subdivided into high MW phthalates (MiNP, MNP, MEHP, and MBzP) and low MW phthalates (MBP, MiBP, and MEP). We found that the high MW phthalates caused greatest levels of activation through PPAR receptors in granulosa cells. In many cases, the lowest concentrations of phthalates caused a modest repression of gene expression compared to control. Most phthalates acted through PPAR-γ and/or PPAR-α. However, the longest phthalate, MiNP, did not act through PPAR-α and the two shortest phthalates, MiBP and MEP, appeared to not act through PPAR-γ.

One way to assess the ability of phthalates to act through the PPAR pathway was to monitor expression of PPAR target genes. The two selected genes, Fabp4 and Cd36, are highly expressed in adipose tissue and are known to be upregulated by the PPAR pathway [46]. These genes are commonly used as markers of activation through PPAR receptors [47–50]. Fabp4 is a fatty acid binding protein gene [51] and Cd36 is a fatty acid receptor gene [52]. High concentrations of fatty acids upregulate Fabp4 and Cd36 in adipose tissue [53], which leads to positive feedback [54], and these genes are regulated by the PPAR pathway in human granulosa cells [55]. Phthalate monoesters have a similar structure to fatty acids, with a negative charge and a hydrophobic tail, and are thought to bind the PPAR receptors in the same ligand binding domain [30], but this had not been tested in detail in granulosa cells.

Our data show that PPAR-γ is much more highly expressed than PPAR-α in granulosa cells (Fig. 2). This is consistent with other studies in granulosa cells [26,27]. Our data also show that a PPAR-γ agonist induces Fabp4 more strongly than Cd36 and that a PPAR-α agonist induces Cd36 more strongly than Fabp4 (Fig. 2). Hence, Fabp4 was used to study the effects of a PPAR-γ antagonist and Cd36 was used to study the effects of a PPAR-α antagonist.

As expected from previous studies with adipose [29,56] and epithelial cell culture [57], the high MW phthalates were able to highly induce expression of Fabp4 and Cd36 in granulosa cells in a largely dose-dependent manner; thus, suggesting activity through the PPAR pathway. MiNP showed an interesting nonmonotonic dose response at the two highest concentrations. This may be related in part to cytotoxic effects at the highest concentration for both MNP and MiNP (Fig. 3). Some of the phthalates caused slight repression of at least one of the genes at low doses, which is consistent with other studies showing that phthalates can repress expression of other ovarian genes [35,36]. Among low MW phthalates, MBP induced expression of both genes in a manner similar to the high MW phthalates, suggesting MBP acts through PPAR pathways. MBP has been previously shown to act through PPAR-α and PPAR-γ in COS-1 cells [28]. An interesting difference seen among the low MW group was that among the two isomers with a four-carbon side chain, the one with the longer side chain, MBP, caused the most dramatic changes in gene expression.

The luminescence assays with transfected firefly luciferase (Fig. 6) corroborated the gene expression analyses (Figs. 4, 5) on a broad scale, with some minor differences. The luminescence assay is specific for activation via PPAR receptors, so the very similar gene expression patterns confirm that most changes seen in the Fabp4 and Cd36 experiments are likely due to PPAR activation. Some minor differences were expected because of differences in the exact sequences and locations of the PPAR response elements of Fabp4, Cd36, and of the transfected luciferase. Other factors include the complex differences in the overall promoter and enhancer regions of the selected genes and the differing contributions of activation through PPAR-δ. The high MW phthalates showed dose-dependent response curves, whereas the low MW phthalates showed little change in luciferase activity. Although MEHP had the highest induction in gene expression analyses, it had the lowest peak activity among the high MW phthalates in the luminescence assay. MiNP and MNP showed nonmonotonic dose-response at the highest doses, similar to MiNP in the gene expression analyses. MiNP and MNP were also able to cause increases in luciferase activity at lower doses than MEHP. This along with the similar trend seen in the gene expression analyses is evidence that the parent compound DiNP (a mixture of isomers) may be capable of more disruptive effects than DEHP at the low doses. Although data on the potency of DiNP metabolites are limited, the levels of phthalate required for activation are slightly higher here than previously reported for MEHP and MBzP [28,29,56–61]. Major differences in this study include the type of cells being assayed and the reliance on expression of endogenous receptors rather than transfection of PPAR genes. The levels of endogenous expression would naturally be much lower than if the PPAR receptors had been overexpressed; however, relying on existing expression levels more closely simulates what would be happening in vivo. Although MBP was able to induce gene expression in the gene expression analyses, the low MW group of phthalates did not cause changes in luciferase activity. Differences such as these can likely also be attributed to the differences among the different promoter/enhancer regions of the luciferase versus the two PPAR target genes in this study.

Antagonists for PPAR-γ and PPAR-α were used to dissect which isoform(s) activation was occurring for the highest concentration of each phthalate. Although 400 μM is not environmentally relevant, because of the high levels of induction caused by many of the phthalates, this dose is where changes in expression caused by an inhibitor have the greatest likelihood of being detected. Fabp4 expression was analyzed ± a PPAR-γ antagonist, and Cd36 expression was analyzed ± a PPAR-α antagonist. All comparisons were normalized as an average of percentage of expression to the corresponding culture without inhibitor. As a positive control, the results show that the effects of each of the PPAR agonists were reversed by the addition of the corresponding antagonist. In the assays for Fabp4 where PPAR-γ antagonist was added, the results show that for most high MW phthalates (MEHP, MBzP, and MiNP) and for one low MW phthalate (MBP) that the inhibitor caused a greater decrease in expression versus the vehicle control culture with inhibitor. It is not surprising that the level of decrease caused by the inhibitor for the two shortest phthalates, MiBP and MEP, is similar to that of the vehicle control culture because no induction of expression was seen without inhibitor for these two phthalates. In assays for Cd36 where PPAR-α antagonist was added, the results show that only one high MW phthalate (MBzP) was inhibited, whereas all three low MW phthalates (MBP, MiBP, and MEP) were inhibited. This is consistent with the data that showed induction of Cd36, but not Fabp4, by MiBP and MEP at the highest dose. Together, these data indicate that induction via PPAR-α may be more likely with shorter phthalates, whereas induction via PPAR-γ may be more likely with longer phthalates in granulosa cells. This agrees with a previous report that the low MW phthalate MBP binds much better to PPAR-α than PPAR-γ in COS-1 cells [28].

Although the inhibition assays detected a significant difference for most of the phthalates tested, there was not a statistically significant interaction between MEHP and PPAR-α as there was for PPAR-γ. This differs from previous studies which showed that MEHP and PPAR-α interact at much lower concentrations in numerous cell types, including COS-1, 3T3L-1, C2C12, HEK293, and F9 cells [28,29,56–58,60]. It is possible that MEHP activates through PPAR-α, but that it is an interaction that is harder to detect than the interaction with PPAR-γ in this experimental design. Additionally, MiNP had a positive result for inhibition with the PPAR-γ inhibitor and a very strong negative result with the PPAR-α inhibitor. This indicates a stronger preference for PPAR-γ than for PPAR-α by MiNP.

The binding of phthalate monoesters to the ligand binding domain has been modeled previously [62–64]. Most of these models show the negatively charged end of the phthalate in close proximity of Y473 (Y464) on H12 of PPAR-γ(PPAR-α); this interaction is important for activation of transcription. Key residues in the binding pocket are conserved between the human and mouse PPAR-γ and PPAR-α receptors. In Fig. 9, MEHP and MBzP are shown as examples of a phthalate monoester binding in similar fashion to PPAR-γ and PPAR-α.

From these experiments interesting comparisons can be made among the high MW phthalates and among the low MW phthalates. Compared to MEHP, the DiNP metabolites MNP and MiNP have more profound effects overall, especially by causing increases through the PPAR pathway at lower concentrations, which have more relevance to human health. These DiNP metabolites also showed nonmonotonic patterns and cytotoxicity at high doses not seen with MEHP. MBzP, which has an aromatic side chain, was unique among the high MW group by causing much higher dose-dependent increases in the luciferase assay at the highest doses. Among the low MW phthalates studied, MBP had the ability to induce gene expression through PPAR pathways most similar to the high MW group. This is interesting since MBP has the longest (not the heaviest) side chain among this group.

In summary, this study shows the ability of common phthalate metabolites to act through endogenously expressed PPAR receptors in granulosa cells. Side-by-side comparisons among high MW phthalates and among low MW phthalates reveal interesting differences for phthalates of very similar molecular weight. Overall, actions of phthalates through granulosa cell PPAR receptors could lead to changes in expression of downstream genes, thus having impacts on ovarian health.

Acknowledgements

The authors would like to thank members of the Flaws Laboratory for technical assistance. Dr. William Arnold provided useful input for data analysis. This work was supported by NIH R01 ES028661, NIH T32 ES007326, NIH K99 ES031150, and NIH P41-GM104601. PPRE X3-Tk-luc was a gift from Bruce Spiegelman (Addgene plasmid #1015; http??n2t.net/addgene:1015).

Footnotes

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  • [1].Moorman WJ, Ahlers HW, Chapin RE, Daston GP, Foster PM, Kavlock RJ, Morawetz JS, Schnorr TM, Schrader SM, Prioritization of NTP reproductive toxicants for field studies, Reprod. Toxicol 14 (2000) 293–301. [DOI] [PubMed] [Google Scholar]
  • [2].Hannon PR, Flaws JA, The effects of phthalates on the ovary, Front. Endocrinol 6 (2015) 8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].Calafat AM, Needham LL, Silva MJ, Lambert G, Exposure to di-(2-ethylhexyl) phthalate among premature neonates in a neonatal intensive care unit, Pediatrics 113 (2004) e429–e434. [DOI] [PubMed] [Google Scholar]
  • [4].US EPA USEPA. Bis(2-ethylhexyl) phthalate (DEHP). 2000.
  • [5].Doull J, Cattley R, Elcombe C, Lake BG, Swenberg J, Wilkinson C, Williams G, van Gemert M, A cancer risk assessment of di(2-ethylhexyl)phthalate: application of the new U.S. EPA risk assessment guidelines, Regul. Toxicol. Pharmacol 29 (1999) 327–357. [DOI] [PubMed] [Google Scholar]
  • [6].Kavlock R, Boekelheide K, Chapin R, Cunningham M, Faustman E, Foster P, Golub M, Henderson R, Hinberg I, Little R, Seed J, Shea K, Tabacova S, Tyl R, Williams P, Zacharewski T, NTP center for the evaluation of risks to human reproduction: phthalates expert panel report on the reproductive and developmental toxicity of di(2-ethylhexyl) phthalate, Reprod. Toxicol 16 (2002) 529–653. [DOI] [PubMed] [Google Scholar]
  • [7].Hines CJ, Hopf NB, Deddens JA, Silva MJ, Calafat AM, Occupational exposure to diisononyl phthalate (DiNP) in polyvinyl chloride processing operations, Int. Arch. Occup. Environ. Health 85 (2012) 317–325. [DOI] [PubMed] [Google Scholar]
  • [8].CPSC USCPSC. Chronic Hazard Advisory Panel On Diisononyl Phthalate (DiNP). 2001.
  • [9].Davis BJ, Weaver R, Gaines LJ, Heindel JJ, Mono-(2-ethylhexyl) phthalate suppresses estradiol production independent of FSH-cAMP stimulation in rat granulosa cells, Toxicol. Appl. Pharmacol 128 (1994) 224–228. [DOI] [PubMed] [Google Scholar]
  • [10].Lovekamp TN, Davis BJ, Mono-(2-ethylhexyl) phthalate suppresses aromatase transcript levels and estradiol production in cultured rat granulosa cells, Toxicol. Appl. Pharmacol 172 (2001) 217–224. [DOI] [PubMed] [Google Scholar]
  • [11].Lovekamp-Swan T, Davis BJ, Mechanisms of phthalate ester toxicity in the female reproductive system, Environ. Health Perspect 111 (2003) 139–145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [12].Wang W, Craig ZR, Basavarajappa MS, Hafner KS, Flaws JA, Mono-(2-ethylhexyl) phthalate induces oxidative stress and inhibits growth of mouse ovarian antral follicles, Biol. Reprod 87 (2012) 152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Hannon PR, Brannick KE, Wang W, Flaws JA, Mono(2-ethylhexyl) phthalate accelerates early folliculogenesis and inhibits steroidogenesis in cultured mouse whole ovaries and antral follicles, Biol. Reprod 92 (2015) 120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [14].Dominguez-Romero E, Scheringer M, A review of phthalate pharmacokinetics in human and rat: what factors drive phthalate distribution and partitioning? Drug Metab. Rev 51 (2019) 314–329. [DOI] [PubMed] [Google Scholar]
  • [15].Warner GR, Li Z, Houde ML, Atkinson CE, Meling DD, Chiang C, Flaws JA, Ovarian metabolism of an environmentally relevant phthalate mixture, Toxicol. Sci 169 (2019) 246–259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Meeker JD, Calafat AM, Hauser R, Urinary metabolites of di(2-ethylhexyl) phthalate are associated with decreased steroid hormone levels in adult men, J. Androl 30 (2009) 287–297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [17].Meeker JD, Hu H, Cantonwine DE, Lamadrid-Figueroa H, Calafat AM, Ettinger AS, Hernandez-Avila M, Loch-Caruso R, Téllez-Rojo MM, Urinary phthalate metabolites in relation to preterm birth in Mexico city, Environ. Health Perspect 117 (2009) 1587–1592. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].Gupta RK, Singh JM, Leslie TC, Meachum S, Flaws JA, Yao HH, Di-(2-ethylhexyl) phthalate and mono-(2-ethylhexyl) phthalate inhibit growth and reduce estradiol levels of antral follicles in vitro, Toxicol. Appl. Pharmacol 242 (2010) 224–230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [19].Toft G, Jönsson BA, Lindh CH, Jensen TK, Hjollund NH, Vested A, Bonde JP, Association between pregnancy loss and urinary phthalate levels around the time of conception, Environ. Health Perspect 120 (2012) 458–463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [20].Ferguson KK, Peterson KE, Lee JM, Mercado-García A, Blank-Goldenberg C, Téllez-Rojo MM, Meeker JD, Prenatal and peripubertal phthalates and bisphenol A in relation to sex hormones and puberty in boys, Reprod. Toxicol 47 (2014) 70–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [21].Ferguson KK, McElrath TF, Ko YA, Mukherjee B, Meeker JD, Variability in urinary phthalate metabolite levels across pregnancy and sensitive windows of exposure for the risk of preterm birth, Environ. Int 70 (2014) 118–124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Johansson HK, Jacobsen PR, Hass U, Svingen T, Vinggaard AM, Isling LK, Axelstad M, Christiansen S, Boberg J, Perinatal exposure to mixtures of endocrine disrupting chemicals reduces female rat follicle reserves and accelerates reproductive aging, Reprod. Toxicol 61 (2016) 186–194. [DOI] [PubMed] [Google Scholar]
  • [23].Ge W, Li L, Dyce PW, De Felici M, Shen W, Establishment and depletion of the ovarian reserve: physiology and impact of environmental chemicals, Cell Mol. Life Sci 76 (2019) 1729–1746. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [24].Kay VR, Chambers C, Foster WG, Reproductive and developmental effects of phthalate diesters in females, Crit. Rev. Toxicol 43 (2013) 200–219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [25].Montaigne D, Butruille L, Staels B, PPAR control of metabolism and cardiovascular functions, Nat. Rev. Cardiol 18 (2021) 809–823. [DOI] [PubMed] [Google Scholar]
  • [26].Komar CM, Peroxisome proliferator-activated receptors (PPARs) and ovarian function–implications for regulating steroidogenesis, differentiation, and tissue remodeling, Reprod. Biol. Endocrinol 3 (2005) 41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [27].Froment P, Gizard F, Defever D, Staels B, Dupont J, Monget P, Peroxisome proliferator-activated receptors in reproductive tissues: from gametogenesis to parturition, J. Endocrinol 189 (2006) 199–209. [DOI] [PubMed] [Google Scholar]
  • [28].Hurst CH, Waxman DJ, Activation of PPARalpha and PPARgamma by environmental phthalate monoesters, Toxicol. Sci 74 (2003) 297–308. [DOI] [PubMed] [Google Scholar]
  • [29].Bility MT, Thompson JT, McKee RH, David RM, Butala JH, Vanden Heuvel JP, Peters JM, Activation of mouse and human peroxisome proliferator-activated receptors (PPARs) by phthalate monoesters, Toxicol. Sci 82 (2004) 170–182. [DOI] [PubMed] [Google Scholar]
  • [30].Sarath Josh MK, Pradeep S, Vijayalekshmi Amma KS, Balachandran S, Abdul Jaleel UC, Doble M, Spener F, Benjamin S, Phthalates efficiently bind to human peroxisome proliferator activated receptor and retinoid X receptor alpha, beta, gamma subtypes: an in silico approach, J. Appl. Toxicol 34 (2014) 754–765. [DOI] [PubMed] [Google Scholar]
  • [31].Lovekamp-Swan T, Jetten AM, Davis BJ, Dual activation of PPARalpha and PPARgamma by mono-(2-ethylhexyl) phthalate in rat ovarian granulosa cells, Mol. Cell Endocrinol 201 (2003) 133–141. [DOI] [PubMed] [Google Scholar]
  • [32].Warner GR, Pacyga DC, Strakovsky RS, Smith R, James-Todd T, Williams PL, Hauser R, Meling DD, Li Z, Flaws JA, Urinary phthalate metabolite concentrations and hot flashes in women from an urban convenience sample of midlife women, Environ. Res 197 (2021), 110891. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [33].Chiang C, Pacyga DC, Strakovsky RS, Smith RL, James-Todd T, Williams PL, Hauser R, Meling DD, Li Z, Flaws JA, Urinary phthalate metabolite concentrations and serum hormone levels in pre- and perimenopausal women from the Midlife Women’s Health Study, Environ. Int 156 (2021), 106633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [34].Brehm E, Zhou C, Gao L, Flaws JA, Prenatal exposure to an environmentally relevant phthalate mixture accelerates biomarkers of reproductive aging in a multiple and transgenerational manner in female mice, Reprod. Toxicol 98 (2020) 260–268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [35].Zhou C, Flaws JA, Effects of an environmentally relevant phthalate mixture on cultured mouse antral follicles, Toxicol. Sci 156 (2017) 217–229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [36].Meling DD, Warner GR, Szumski JR, Gao L, Gonsioroski AV, Rattan S, Flaws JA, The effects of a phthalate metabolite mixture on antral follicle growth and sex steroid synthesis in mice, Toxicol. Appl. Pharmacol 388 (2020), 114875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [37].Koch HM, Calafat AM, Human body burdens of chemicals used in plastic manufacture, Philos. Trans. R. Soc. Lond. B Biol. Sci 364 (2009) 2063–2078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [38].Hauser R, Duty S, Godfrey-Bailey L, Calafat AM, Medications as a source of human exposure to phthalates, Environ. Health Perspect 112 (2004) 751–753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [39].Heudorf U, Mersch-Sundermann V, Angerer J, Phthalates: toxicology and exposure, Int. J. Hyg. Environ. Health 210 (2007) 623–634. [DOI] [PubMed] [Google Scholar]
  • [40].Craig ZR, Hannon PR, Wang W, Ziv-Gal A, Flaws JA, Di-n-butyl phthalate disrupts the expression of genes involved in cell cycle and apoptotic pathways in mouse ovarian antral follicles, Biol. Reprod 88 (2013) 23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [41].Kitchen DB, Decornez H, Furr JR, Bajorath J, Docking and scoring in virtual screening for drug discovery: methods and applications, Nat. Rev. Drug Discov 3 (2004) 935–949. [DOI] [PubMed] [Google Scholar]
  • [42].Humphrey W, Dalke A, Schulten K, VMD: visual molecular dynamics, J. Mol. Graph 14 (33–8) (1996) 27–28. [DOI] [PubMed] [Google Scholar]
  • [43].Jumper J, Evans R, Pritzel A, Green T, Figurnov M, Ronneberger O, Tunyasuvunakool K, Bates R, Žídek A, Potapenko A, Bridgland A, Meyer C, Kohl S, Ballard AJ, Cowie A, Romera-Paredes B, Nikolov S, Jain R, Adler J, Back T, Petersen S, Reiman D, Clancy E, Zielinski M, Steinegger M, Pacholska M, Berghammer T, Bodenstein S, Silver D, Vinyals O, Senior AW, Kavukcuoglu K, Kohli P, Hassabis D, Highly accurate protein structure prediction with AlphaFold, Nature 596 (2021) 583–589. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [44].Lee G, Elwood F, McNally J, Weiszmann J, Lindstrom M, Amaral K, Nakamura M, Miao S, Cao P, Learned RM, Chen JL, Li Y, T0070907, a selective ligand for peroxisome proliferator-activated receptor gamma, functions as an antagonist of biochemical and cellular activities, J. Biol. Chem 277 (2002) 19649–19657. [DOI] [PubMed] [Google Scholar]
  • [45].Xu HE, Stanley TB, Montana VG, Lambert MH, Shearer BG, Cobb JE, McKee DD, Galardi CM, Plunket KD, Nolte RT, Parks DJ, Moore JT, Kliewer SA, Willson TM, Stimmel JB, Structural basis for antagonist-mediated recruitment of nuclear co-repressors by PPARalpha, Nature. 415 (2002) 813–817. [DOI] [PubMed] [Google Scholar]
  • [46].Fang L, Zhang M, Li Y, Liu Y, Cui Q, Wang N, PPARgene: a database of experimentally verified and computationally predicted PPAR target genes, PPAR Res. 2016 (2016), 6042162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [47].Gogg S, Nerstedt A, Boren J, Smith U, Human adipose tissue microvascular endothelial cells secrete PPARgamma ligands and regulate adipose tissue lipid uptake, JCI Insight 4 (2019) 4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [48].Jiang Y, Lin L, Liu N, Wang Q, Yuan J, Li Y, Chung KK, Guo S, Yu Z, Wang X, FGF21 protects against aggravated blood-brain barrier disruption after ischemic focal stroke in diabetic db/db male mice via cerebrovascular PPARgamma activation, Int. J. Mol. Sci 21 (2020) 21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [49].Gao P, Wang L, Yang N, Wen J, Zhao M, Su G, Zhang J, Weng D, Peroxisome proliferator-activated receptor gamma (PPARgamma) activation and metabolism disturbance induced by bisphenol A and its replacement analog bisphenol S using in vitro macrophages and in vivo mouse models, Environ. Int 134 (2020), 105328. [DOI] [PubMed] [Google Scholar]
  • [50].Yang PB, Hou PP, Liu FY, Hong WB, Chen HZ, Sun XY, Li P, Zhang Y, Ju CY, Luo LJ, Wu SF, Zhou JX, Wang ZJ, He JP, Li L, Zhao TJ, Deng X, Lin T, Wu Q, Blocking PPARgamma interaction facilitates Nur77 interdiction of fatty acid uptake and suppresses breast cancer progression, Proc. Natl. Acad. Sci. USA 117 (2020) 27412–27422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [51].Furuhashi M, Ogura M, Matsumoto M, Yuda S, Muranaka A, Kawamukai M, Omori A, Tanaka M, Moniwa N, Ohnishi H, Saitoh S, Harada-Shiba M, Shimamoto K, Miura T, Serum FABP5 concentration is a potential biomarker for residual risk of atherosclerosis in relation to cholesterol efflux from macrophages, Sci. Rep 7 (2017) 217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [52].Pepino MY, Kuda O, Samovski D, Abumrad NA, Structure-function of CD36 and importance of fatty acid signal transduction in fat metabolism, Annu. Rev. Nutr 34 (2014) 281–303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [53].Hotamisligil GS, Bernlohr DA, Metabolic functions of FABPs–mechanisms and therapeutic implications, Nat. Rev. Endocrinol 11 (2015) 592–605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [54].Lamas Bervejillo M, Bonanata J, Franchini GR, Richeri A, Marqués JM, Freeman BA, Schopfer FJ, Coitiño EL, Córsico B, Rubbo H, Ferreira AM, A FABP4-PPARgamma signaling axis regulates human monocyte responses to electrophilic fatty acid nitroalkenes, Redox. Biol 29 (2020), 101376. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [55].Hu W, Qiao J, Expression and regulation of adipocyte fatty acid binding protein in granulosa cells and its relation with clinical characteristics of polycystic ovary syndrome, Endocrine 40 (2011) 196–202. [DOI] [PubMed] [Google Scholar]
  • [56].Feige JN, Gelman L, Rossi D, Zoete V, Métivier R, Tudor C, Anghel SI, Grosdidier A, Lathion C, Engelborghs Y, Michielin O, Wahli W, Desvergne B, The endocrine disruptor monoethyl-hexyl-phthalate is a selective peroxisome proliferator-activated receptor gamma modulator that promotes adipogenesis, J. Biol. Chem 282 (2007) 19152–19166. [DOI] [PubMed] [Google Scholar]
  • [57].Lampen A, Zimnik S, Nau H, Teratogenic phthalate esters and metabolites activate the nuclear receptors PPARs and induce differentiation of F9 cells, Toxicol. Appl. Pharmacol 188 (2003) 14–23. [DOI] [PubMed] [Google Scholar]
  • [58].Maloney EK, Waxman DJ, trans-Activation of PPARalpha and PPARgamma by structurally diverse environmental chemicals, Toxicol. Appl. Pharmacol 161 (1999) 209–218. [DOI] [PubMed] [Google Scholar]
  • [59].Desvergne B, Feige JN, Casals-Casas C, PPAR-mediated activity of phthalates: a link to the obesity epidemic? Mol. Cell Endocrinol 304 (2009) 43–48. [DOI] [PubMed] [Google Scholar]
  • [60].Engel A, Buhrke T, Imber F, Jessel S, Seidel A, Völkel W, Lampen A, Agonistic and antagonistic effects of phthalates and their urinary metabolites on the steroid hormone receptors ERalpha, ERbeta, and AR, Toxicol. Lett 277 (2017) 54–63. [DOI] [PubMed] [Google Scholar]
  • [61].Garoche C, Boulahtouf A, Grimaldi M, Chiavarina B, Toporova L, den Broeder MJ, Legler J, Bourguet W, Balaguer P, Interspecies differences in activation of peroxisome proliferator-activated receptor gamma by pharmaceutical and environmental chemicals, Environ. Sci. Technol 55 (2021) 16489–16501. [DOI] [PubMed] [Google Scholar]
  • [62].Kratochvil I, Hofmann T, Rother S, Schlichting R, Moretti R, Scharnweber D, Hintze V, Escher BI, Meiler J, Kalkhof S, von Bergen M, Mono(2-ethylhexyl) phthalate (MEHP) and mono(2-ethyl-5-oxohexyl) phthalate (MEOHP) but not di(2-ethylhexyl) phthalate (DEHP) bind productively to the peroxisome proliferator-activated receptor gamma, Rapid Commun. Mass Spectrom 33 (Suppl 1) (2019) 75–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [63].Kambia N, Renault N, Dilly S, Farce A, Dine T, Gressier B, Luyckx M, Brunet C, Chavatte P, Molecular modelling of phthalates - PPARs interactions, J. Enzyme Inhib. Med. Chem 23 (2008) 611–616. [DOI] [PubMed] [Google Scholar]
  • [64].Kaya T, Mohr SC, Waxman DJ, Vajda S, Computational screening of phthalate monoesters for binding to PPARgamma, Chem. Res. Toxicol 19 (2006) 999–1009. [DOI] [PubMed] [Google Scholar]

RESOURCES