TABLE 2.

Nucleotide and amino acid variants within the gene and mature protein of the CSN1S2.

Encoded protein variant	Protein/DNA variant name	Position on chr 6 (bp) a	86,080,969	86,081,790	86,081,847	86,081,887	86,084,638	86,085,134	86,085,160	86,085,167	86,085,714	86,089,401	86,089,407	86,089,479	References
		Position on the gene	E–3	E–4	I–4	E–5	E–9	E–11	E–11	E–11 & I–12	E–12	E–16	E–16	E–16
		Amino acid position b	7	17		20	64	110	119	121-122-123-124	127	167	169	197
CSN1S2*A	CSN1S2*A	NC_030813	G	T		T	G	G	G		G	A	G	C	Boulanger et al. (1984); Bouniol et al. (1993); Bickhart et al., 2017
		XP_013820127.2	Val	Phe		Ile	Glu	W	Ala	Thr-Pro-Thr-Val	Glu	Lys	Ser	Pro
CSN1S2*B	CSN1S2*B	CSN1S2*B_Gen.					A								Boulanger et al. (1984); Bouniol et al. (1993)
		CSN1S2*B_Prot.					Lys
CSN1S2*C	CSN1S2*C	CSN1S2*C_Gen.										T			Bouniol et al. (1994)
		CSN1S2*C_Prot.										Ile
CSN1S2*D	CSN1S2*D	CSN1S2*D_Gen.								Del-1					Ramunno et al. (2001a)
		CSN1S2*D_Prot.								Asn-Del-2-Del-3-Del-4
CSN1S2*E	CSN1S2*E	CSN1S2*E_Gen.			Del-5							T		G	Veltri et al. (2000); Lagonigro et al. (2001)
		CSN1S2*E_Prot.										Ile		Arg
CSN1S2*F	CSN1S2*F	CSN1S2*F_Gen.	A												Ramunno et al. (2001a)
		CSN1S2*F_Prot.	Ile
CSN1S2*G	CSN1S2*G*	CSN1S2*G_Gen.													NCD; Erhardt et al. (2002)
		CSN1S2*G_Prot.
CSN1S2*H	CSN1S2*H	CSN1S2*H_Gen.							C						Rahmatalla et al. (2021)
		CSN1S2*H_Prot.							Pro
CSN1S2*I	CSN1S2*I	CSN1S2*I_Gen.							C		A				Rahmatalla et al. (2021)
		CSN1S2*I_Prot.							Pro		Lys
CSN1S2*J	CSN1S2*J	CSN1S2*J_Gen.				C			C				A		Rahmatalla et al. (2021)
		CSN1S2*J_Prot.				Thr			Pro				Asn
CSN1S2*K	CSN1S2*K	CSN1S2*k_Gen.		C		C			C		A		A		Rahmatalla et al. (2021)
		CSN1S2*K_Prot.		Ser		Thr			Pro		Lys		Asn
CSN1S2*0	CSN1S2*0	CSN1S2*0_Gen.						A							Ramunno et al. (2001b)
		CSN1S2*0_Prot.						Pre mature Stop codon	NT	NT	NT	NT	NT	NT
Truncated sub variant A	Truncated sub variant Ac	Truncated sub variant A_Gen.													NCD; Cunsolo et al., 2006
		Truncated sub variant A_Prot.
Truncated sub variant E	Truncated sub variant Ec	Truncated sub variant E_Gen.													NCD; Cunsolo et al., 2006
		Truncated sub variant E_Prot.

^a Chromosomal position in base pairs (bp) in the positive strand according to the goat genome reference version LWLT01, which represent CSN1S2*A.

^b Amino acids position according to the reference protein sequence XP_013820127.2. The whole sequence of 223 amino acids comprises 208 of the mature protein. All the amino acid position based on the mature protein.

*: CSN1S2*G variant has an isoelectric point between CSN1S2*A and CSN1S2*C.

Del-1: Deletion of 106 bp (CTCCCACCGTGGTGAGTGCTGCTTTTTTATATGTTGTTTCTTGTTTATTTTTTTTTTCTTTCTGTTTTTGGTGAAGGATGAGTTCAGGATAAAGATTTGTAAAATG)

^c Deletion of the C-terminal tetra peptide.

Del-2: Deletion of the amino acid Proline (Pro).

Del-3: Deletion of the amino acid Threonine (Thr).

Del-4: Deletion of the amino acid Valine (Val).

Del-5: Deletion of 4 bp (AAAT).

Del.: Deletion.

NCD: Not characterize at the DNA level.

NT: Not translated after stop codon.