FIG. 2.

Analysis of msp2 transcript structure by RT-PCR, primer extension analysis, and RNase protection assay (RPA). For RT-PCR, total DNase-treated RNA of Florida strain A. marginale was reverse transcribed into DNA using oligonucleotide primer AB198, which anneals to the 3′ end of msp2. The cDNA was amplified in a primary PCR with primers AB765 and AB766, which generated a product of 3.2 kbp. The primary PCR product was amplified in a secondary or nested PCR with primer combinations AB192 and AB764, AB689 and AB764, and AB192 and AB688 to generate products of 2.0, 1.5, and 0.7 kbp, respectively. See Fig. 1 for the locations of RT-PCR products. S, molecular size standards; +, with reverse transcriptase; −, negative control reactions without reverse transcriptase. For primer extension, oligonucleotide primer AB784, which anneals 153 nucleotides 3′ to the ATG initiation codon of orf4, was radiolabeled with ³²P and extended in sequencing reactions using reverse transcriptase and either total RNA of A. marginale or denatured, PCR-amplified genomic DNA containing orf2 to orf4, msp2, and flanking regions as templates. The order of sequencing reactions T, G, C, and A, is shown above the DNA lanes and was the same in the RNA lanes. A strong stop was detected in RNA at the A (underlined) in sequence TGCAACCCACACACCCATAAGG, with evidence also for a minority of transcripts continuing to the next base, C (italic). This corresponds to the coding-strand sequence CCTTATGGGTGTGTGGGTTGCA (see the text). For the RNase protection assay, a ³²P-labeled antisense RNA probe of 722 nucleotides (317 nucleotides of the msp2 gene, 307 nucleotides of orf2 and intercistronic spacer, 98 nucleotides of plasmid vector) was allowed to hybridize to various amounts (10, 3, and 0.1 μg) of total RNA of A. marginale and carrier yeast RNA or to yeast RNA alone (lane 0) and then unprotected single-stranded probe was digested with RNase and analyzed by denaturing polyacrylamide gel electrophoresis. C, probe plus yeast RNA, not digested with RNase. The positions of molecular size standards are shown on the left. A band of 624 bp containing the A. marginale sequences within the probe (msp2 and orf2) was the predominant fragment protected.