Key resources table.
(CELL-CHEMICAL-BIOLOGY-D-21-00395)
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse monoclonal anti-GPX4 | R&D systems | Cat# MAB5457, RRID:AB_2232542 |
| Rabbit monoclonal anti-actin | Cell Signaling | Cat# 8456, RRID:AB_10998774 |
| Rabbit polyclonal anti-GAPDH | Abcam | Cat# ab9485, RRID:AB_307275 |
| Bacterial and virus strains | ||
| E. coli BL21-Gold (DE3) competent cells | Agilent | Cat# 230132 |
| Biological samples | ||
| Chemicals, peptides, and recombinant proteins | ||
| His-tagged-c-GPX4U46C | This paper | N/A |
| His-tagged-c-GPX4U46C_R152H | This paper | N/A |
| His-tagged-c-GPX4U46C_C66S | This paper | N/A |
| His-tagged-c-GPX4AllCys(-)-A46C | This paper | N/A |
| 15N-labeled His-tagged-c-GPX4U46C | This paper | N/A |
| 13C, 15N-labeled His-tagged-c-GPX4U46C | This paper | N/A |
| (1S,3R)-RSL3 | Yang et al.16 | N/A |
| (1S,3R)-RSL3-minus-Cl | This paper | N/A |
| ML162 | Aobious | Cat# AOB1514 |
| FIN56 | Gaschler et al.27 | N/A |
| FINO2 | Gaschler et al.27 | N/A |
| Fer-1 | Gaschler et al.27 | N/A |
| IKE | Zhang et al.30 | N/A |
| CDS9 | Sigma-Aldrich | Cat# CDS006509 |
| TMT10 | Millipore Sigma | Cat# TMT00610 |
| MAC-5576 | Maybridge | Cat# MAC-5576 |
| LOC1886 | This paper | N/A |
| Critical commercial assays | ||
| Site-directed mutagenesis kit QuickChange II | Agilent | Cat# 200521 |
| CellTiter-Glo luminescent cell viability | Promega | Cat# G7573 |
| Pierce BCA Protein Assay Kit | Thermo Fisher | Cat# 23225 |
| Deposited data | ||
| GPX4-U46C crystal structure | Liu et al.32 | PDB ID: 7L8K |
| GPX4-U46C-R152H crystal structure | Liu et al.32 | PDB ID: 7L8L |
| GPX4-RSL3 crystal structure | This paper | PDB ID: 7U4N |
| GPX4-ML162 crystal structure | This paper | PDB ID: 7U4K |
| GPX4-CDS9 crystal structure | This paper | PDB ID: 7U4I |
| GPX4-TMT10 crystal structure | This paper | PDB ID: 7U4J |
| GPX4-MAC-5576 crystal structure | This paper | PDB ID: 7U4L |
| GPX4-LOC1886 crystal structure | This paper | PDB ID: 7U4M |
| Backbone NMR Chemical Shift Assignments of GPX4 | This paper | BMRB entry 51659 |
| Proteomics data of GPX4 treated with inhibitors | This paper | MassIVE code: MSV000090526 |
| Experimental models: Cell lines | ||
| HT-1080 | ATCC | Cat# CCL-121 |
| HT-1080 OE GFP-tagged-cyto-GPX4WT | This paper | N/A |
| HT-1080 OE GFP-tagged-cyto-GPX4C66S | This paper | N/A |
| HT-1080 OE GFP-tagged-cyto-GPX4C10S-C66S | This paper | N/A |
| HT-1080 OE GFP-tagged-cyto-GPX4U46C | This paper | N/A |
| HT-1080 OE GFP-tagged-cyto-GPX4U46C-C66S | This paper | N/A |
| HT-1080 OE tag-free-cyto-GPX4WT | This paper | N/A |
| HT-1080 OE tag-free-cyto-GPX4C66S | This paper | N/A |
| G401 | ATCC | Cat# CRL-1441 |
| G401 OE GFP-tagged-GPX4WT | Yang et al.16 | N/A |
| G401 OE GFP-tagged-GPX4allCys(-)-A10C | Yang et al.16 | N/A |
| G401 OE GFP-tagged-GPX4allCys(-)-A46C | Yang et al.16 | N/A |
| G401 OE GFP-tagged-GPX4allCys(-)-A46U | Yang et al.16 | N/A |
| G401 OE GFP-tagged-GPX4allCys(-)-A66C | Yang et al.16 | N/A |
| G401 OE GFP-tagged-GPX4allCys(-)-A107C | Yang et al.16 | N/A |
| G401 OE GFP-tagged-GPX4allCys(-)-A148C | Yang et al.16 | N/A |
| Experimental models: Organisms/strains | ||
| Oligonucleotides | ||
| R152H mutagenesis primers Foward: CTGCGTGGTGAAGCACTACGGACCCATGG | This paper | N/A |
| R152H mutagenesis primers Reverse: CCATGGGTCCGTAGTGCTTCACCACGCAG | This paper | N/A |
| C66S mutagenesis primers Foward: CCCGATACGCTGAGAGTGGTTTGCGGATC | This paper | N/A |
| C66S mutagenesis primers Reverse: GATCCGCAAACCACTCTCAGCGTATCGGG | This paper | N/A |
| C10S mutagenesis primers Foward: GGAGCGCGCACTGCGCCAGTCG | This paper | N/A |
| C10S mutagenesis primers Reverse: GGAGCGCGCACTGCGCCAGTCG | This paper | N/A |
| Recombinant DNA | ||
| pET-15b-His-tagged-c-GPX4U46C | Yang et al.16 | N/A |
| pET-15b-His-tagged-c-GPX4U46C−R152H | This paper | N/A |
| pET-15b-His-tagged-c-GPX4U46C_C66S | This paper | N/A |
| pET-15b-His-tagged-c-GPX4AllCys(-)-A46C | Yang et al.16 | N/A |
| pBabe-puro GFP-tagged-cyto-GPX4WT | Yang et al.8 | N/A |
| pBabe-puro tag-free-cyto-GPX4WT | Yang et al.8 | N/A |
| pBabe-puro GFP-tagged-cyto-GPX4U46C | Yang et al.8 | N/A |
| pBabe-puro GFP-tagged-cyto-GPX4C66S | This paper | N/A |
| pBabe-puro tag-free-cyto-GPX4C66S | This paper | N/A |
| pBabe-puro GFP-tagged-cyto-GPX4U46C-C66S | This paper | N/A |
| pBabe-puro GFP-tagged-cyto-GPX4C10S-C66S | This paper | N/A |
| Software and algorithms | ||
| Maestro, v2020-3 | Schrodinger | https://www.schrodinger.com/products/maestro |
| PyMOL, v2.5.0 | Schrodinger | https://pymol.org/2/ |
| GraphPad Prism 9 | GraphPad Software | https://www.graphpad.com/ |
| MOLREP, v11.0 | Vagin and Teplyakov37 | https://www.ccp4.ac.uk/html/molrep.html |
| XtalView 4.0 | McRee38 | https://www.sdsc.edu/CCMS/Packages/XTALVIEW/xtalview.html |
| Coot, 0.9.1 | Emsley et al.39 | https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ |
| Phenix, 1.14-3260 | Adams et al.40 | https://phenix-online.org/download |
| ImageJ, v1.51 | Schneider et al. 42 | https://imagej.nih.gov/ij/download.html |
| Protein Thermal Shift, v1.4 | Thermo Fisher | https://www.thermofisher.com/order/catalog/product/4466038 |
| CcpNmr, v3 | Skinner et al.47 | https://ccpn.ac.uk/software/downloads/ |
| Thermo Xcalibur, v4.5.445.18 | Thermo Fisher | https://www.thermofisher.com/order/catalog/product/OPTON-30965 |
| Other | ||